ID: 1152448251

View in Genome Browser
Species Human (GRCh38)
Location 17:80359127-80359149
Sequence ATCATCAGGCCTGCGGAAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 133
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 119}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152448251_1152448262 25 Left 1152448251 17:80359127-80359149 CCCCCTTCCGCAGGCCTGATGAT 0: 1
1: 0
2: 1
3: 12
4: 119
Right 1152448262 17:80359175-80359197 AGCTTCCACTTCAGCTTTCAGGG 0: 1
1: 0
2: 1
3: 28
4: 240
1152448251_1152448261 24 Left 1152448251 17:80359127-80359149 CCCCCTTCCGCAGGCCTGATGAT 0: 1
1: 0
2: 1
3: 12
4: 119
Right 1152448261 17:80359174-80359196 TAGCTTCCACTTCAGCTTTCAGG 0: 1
1: 0
2: 0
3: 14
4: 205
1152448251_1152448263 26 Left 1152448251 17:80359127-80359149 CCCCCTTCCGCAGGCCTGATGAT 0: 1
1: 0
2: 1
3: 12
4: 119
Right 1152448263 17:80359176-80359198 GCTTCCACTTCAGCTTTCAGGGG 0: 1
1: 0
2: 1
3: 22
4: 207

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152448251 Original CRISPR ATCATCAGGCCTGCGGAAGG GGG (reversed) Intronic