ID: 1152449480

View in Genome Browser
Species Human (GRCh38)
Location 17:80367974-80367996
Sequence TCTCCCAGGCAGATGGAGCA CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 367
Summary {0: 1, 1: 0, 2: 4, 3: 40, 4: 322}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152449480 Original CRISPR TCTCCCAGGCAGATGGAGCA CGG (reversed) Exonic
900473859 1:2867290-2867312 GCTCCCACGCAGCTGGGGCAGGG - Intergenic
902652810 1:17847502-17847524 TAGCCCAGGCAGAGGCAGCAAGG - Intergenic
902742509 1:18448729-18448751 TGTCCAAGGCAGATGGAGATAGG - Intergenic
902776727 1:18679542-18679564 ACGCCCAGGAAGCTGGAGCAGGG - Intronic
903586452 1:24419316-24419338 TCTCCCAGGCAGACAGAGAGGGG - Exonic
903808504 1:26021859-26021881 GCTCCAAGCCAGATGGTGCAAGG + Exonic
904012414 1:27397462-27397484 TCTGCCAGGGAAATGGAGAAAGG - Intergenic
904256525 1:29258352-29258374 TCACCCAGGGAGGTGGAGCTGGG + Intronic
904400357 1:30252654-30252676 GCTCCCTGCCAGGTGGAGCATGG - Intergenic
904809999 1:33157262-33157284 TTTCCCAGGCAGGAAGAGCAAGG - Intronic
906250627 1:44308209-44308231 TCTACAAGGCAGCTGGATCAGGG - Intronic
906901493 1:49841838-49841860 TCTCACAGTCAGGCGGAGCAGGG + Intronic
907221742 1:52911978-52912000 TCTCTGAGGCAGAAAGAGCAAGG - Intronic
907923350 1:58933194-58933216 TGTCCCAGGCAGCTGGAGGAAGG - Intergenic
907925708 1:58953529-58953551 TCTTCCATGCACATGGTGCAAGG - Intergenic
908206473 1:61855524-61855546 ACTACCAGGGAGGTGGAGCAGGG - Intronic
909785788 1:79610973-79610995 TCTGCCAGGGAGCTGGAGCATGG - Intergenic
909991091 1:82223574-82223596 TCACCCAGGCTGATGGAGTGTGG + Intergenic
910119377 1:83768665-83768687 TCTCCCAGGCAGACAGAGCCAGG + Intergenic
912649014 1:111421782-111421804 CCCCACAGGCAGAAGGAGCAGGG - Intronic
912998149 1:114552349-114552371 TCTCCCAGGCCATTGGACCACGG + Intergenic
913319796 1:117580203-117580225 TCCCCCAGGCTGGAGGAGCAGGG - Intergenic
914754711 1:150556348-150556370 TCACCCAGGTAGTTGGAGCTAGG - Exonic
914861894 1:151393100-151393122 TCTATCAGGCAGATAGAGTAAGG - Intergenic
914898696 1:151699407-151699429 TCTGCCATGCAGATAGAGCCTGG + Intergenic
915846901 1:159276259-159276281 TCTTCAAGGAAGATGGAGCTGGG + Intergenic
916479328 1:165201116-165201138 TCTCCCAGGAAGCTGGAGTTAGG + Intergenic
916610495 1:166386765-166386787 TATCCCAGGCAATTAGAGCAGGG + Intergenic
917442940 1:175082843-175082865 TATCCCAGGCTGAGGGAGCCTGG - Intronic
917710781 1:177681845-177681867 GTTTCCAGGCAGATGGAGAAGGG + Intergenic
918070806 1:181132120-181132142 ACTGCCTGGCAGATGGAGGAGGG + Intergenic
918525178 1:185456873-185456895 CCTTCCAGGCAGAGGGAGCAGGG - Intergenic
920215621 1:204359920-204359942 TTTCCCAGGCAGAGGCAGCTGGG + Intronic
920270235 1:204757254-204757276 TTGCCCAGGCAGATGCAGGATGG + Intergenic
921075289 1:211695734-211695756 TCTCACAGACAGCTGGAGGAGGG - Intergenic
922163759 1:223097732-223097754 TCTCCCAGGAAGCTGGGGCTTGG - Intergenic
923022352 1:230174841-230174863 TGTACCAGACAGATGGAACAAGG - Intronic
923057501 1:230438105-230438127 ATTCCCAGGCAGAGGGAGCATGG - Intergenic
924317878 1:242817306-242817328 TCTCCTAGGCAGATAGGGGAGGG - Intergenic
1065195345 10:23258780-23258802 TCCCCCAGGAATATGGAACATGG + Intergenic
1065236861 10:23660757-23660779 TCTCCCCTGCAGATTGAGAATGG + Intergenic
1065446581 10:25808460-25808482 TCCCCCAGGCAATTGGAGAAAGG + Intergenic
1065880833 10:30036563-30036585 TCACCCAGGCAGCTGCAGCCTGG + Intronic
1066307637 10:34162068-34162090 TCTCCTAGGCAGATAGGGAAGGG + Intronic
1067426993 10:46217876-46217898 TCTGCCAGGCAGGCTGAGCAGGG - Intergenic
1067428540 10:46227130-46227152 TCAGCCAGACAGAAGGAGCAGGG - Intergenic
1067437898 10:46291833-46291855 AGTCCCAGGCAGATGGGGCTGGG + Intronic
1069469821 10:68677976-68677998 TCACCCAGGCAGAGTGAGGAGGG + Intronic
1069780499 10:70952486-70952508 TCTCCCAGGCTGATGGGGGTTGG + Intergenic
1069840042 10:71334037-71334059 TCTGCCAGGCAGGGTGAGCAAGG - Intronic
1070279460 10:75038072-75038094 TCTTACCTGCAGATGGAGCAGGG + Exonic
1070831060 10:79418399-79418421 CCTGGCAGGCAGAGGGAGCATGG - Intronic
1071439719 10:85679588-85679610 TTTTCCAGGCAGAAGGAACAAGG + Intronic
1073150585 10:101308766-101308788 TCTCCCAGGGAGATGGGGGATGG - Intergenic
1073424638 10:103449051-103449073 TACCCCAGCCAGATTGAGCATGG - Intronic
1074015609 10:109530726-109530748 TCTCCCAGCCAGAAGGCACAGGG - Intergenic
1074312714 10:112336253-112336275 TCTCCCAGGCACCTGAAGCCTGG - Intergenic
1074619656 10:115106016-115106038 TTTTCCAGGCACATGGTGCAAGG - Intronic
1075040138 10:119101618-119101640 TGTCACAGACAGATGGAGCTGGG - Intergenic
1075894893 10:125986631-125986653 TCTCCCAGGCAGTCTGAGAAAGG - Intronic
1076107291 10:127833947-127833969 TGTCCCAGGCAGGTGGAGTGGGG + Intergenic
1076499126 10:130921964-130921986 TCTCCAAGGCAGTTGGAGACAGG - Intergenic
1077179115 11:1204326-1204348 TCCCCCAGGCTGATGGAGAAGGG + Intergenic
1077300415 11:1844114-1844136 TGGCCCAGGCAGCTGGAGCAGGG + Intergenic
1078138344 11:8671449-8671471 TCTCCAAGGCAGAGAGAGAATGG - Intronic
1078463608 11:11533900-11533922 CCTGCCTGGCAGATGGAGTAGGG + Intronic
1078750566 11:14158117-14158139 TCTAGCAGGCAGTTGGAGTATGG + Intronic
1079460952 11:20677345-20677367 TCTCTGAGGCAGGTGGATCAGGG + Intronic
1079688394 11:23391655-23391677 TCTCCCTGCCAGAAGGAGGAGGG + Intergenic
1080441307 11:32297266-32297288 TCTCCCAAATAGATGGGGCATGG - Intergenic
1081069605 11:38595039-38595061 TCTCCTAGGCAGATAAAGGAGGG + Intergenic
1081195040 11:40151011-40151033 TCTTGCAGGCATATGGAGCATGG - Intronic
1083925188 11:65801740-65801762 TCTCCCAGGCAGAGGTGGCATGG + Intergenic
1084039288 11:66532059-66532081 TCTCCCTGGCTGATTGTGCAGGG - Exonic
1084534893 11:69750813-69750835 TCTGCCAGGCAGCTGGAGTCTGG - Intergenic
1085003450 11:73061996-73062018 TCTCCCAGTCAGGAGGAACAGGG - Intronic
1088261458 11:107948072-107948094 CCTCCCAGGAAGATGGTGAAGGG + Intronic
1089790108 11:120936807-120936829 GCTCCCAGGCGGAAAGAGCAGGG - Intronic
1089896038 11:121930821-121930843 TCTCCAAGCCAGCTGCAGCATGG - Intergenic
1090806952 11:130208783-130208805 TCTGCCAGGCAGAGGGAGACTGG - Intronic
1091756660 12:3056798-3056820 TCCCCCATGGAGATGGAGTAGGG + Intergenic
1091767331 12:3130159-3130181 TTTCCCAGGCTGGTGGGGCAGGG - Intronic
1092787705 12:12043208-12043230 TCTCCCAGGAGGATGCAACAAGG - Intergenic
1095641790 12:44494404-44494426 TGAACCAGCCAGATGGAGCATGG + Intergenic
1096549422 12:52362525-52362547 TCACCCAAGCTGATGGAGCCAGG + Intronic
1096835964 12:54351575-54351597 TTCCCCAGGAAGATGGAGAATGG + Intronic
1097867318 12:64569509-64569531 TCCCCAAGGGAGATGGAGCTGGG - Intergenic
1098498081 12:71160085-71160107 TATTCCAGGCAGAAGGAACAAGG - Intronic
1099053398 12:77808628-77808650 TCTCCCAGTCAGGAGGCGCAGGG + Intergenic
1100971997 12:100080222-100080244 TTTTCCAGGCACATGGTGCAAGG - Intronic
1102194464 12:111014727-111014749 GCACCAAGGCAGAGGGAGCAGGG - Intergenic
1102584677 12:113914724-113914746 TCTCCGAGGCAGATGGAGAAAGG - Intronic
1103684793 12:122723450-122723472 TATTCCAGGCAGATGTAGAAAGG - Intergenic
1103902067 12:124308568-124308590 TCTCCCTGGGAGGTGGGGCATGG - Intronic
1104153726 12:126110039-126110061 TCCCCCAGGCACTTGGAGGAGGG + Intergenic
1104332006 12:127855746-127855768 ACTCCCAGGCAGGTGCAGCCAGG + Intergenic
1107410482 13:40153432-40153454 AGTCCCAGGCAGATGGCTCATGG + Intergenic
1108122850 13:47208451-47208473 TCTGCCAGGCAGCTGGAGTCTGG - Intergenic
1108575676 13:51788514-51788536 TCTCCCTGGCAGATGGAAGAAGG - Intronic
1108707254 13:53000860-53000882 TCTGGCCTGCAGATGGAGCAAGG + Intergenic
1110507067 13:76299307-76299329 TTTCTCAGGCAGATGGTCCAAGG - Intergenic
1112214170 13:97413002-97413024 TCTTCTAGGCAGAAGGAACATGG - Intergenic
1112285114 13:98097065-98097087 TCTCCCAGGAAGTGGGGGCATGG + Intergenic
1112486743 13:99827126-99827148 ATTCCCAGGCAGATGAGGCAGGG + Intronic
1112826552 13:103398515-103398537 TTTTCCAGGCACATGGTGCAAGG + Intergenic
1112829862 13:103436391-103436413 TCTCCCAGGCAGACACAGAAGGG - Intergenic
1113630557 13:111880265-111880287 TCCCGCAGTCAGCTGGAGCAGGG + Intergenic
1113630615 13:111880501-111880523 TCCCGCAGGCAGATGGAGGAGGG + Intergenic
1113831492 13:113298904-113298926 TGGCCGAGGCAGATGGATCATGG + Intronic
1115644917 14:35362361-35362383 TCACCCAGGCAGATGATGCTGGG + Intergenic
1116511823 14:45756061-45756083 TCTCCCAGGCAGGAGGCACAAGG + Intergenic
1117385954 14:55212936-55212958 TCTCCTAGGCAGATAGGGGAGGG - Intergenic
1118846033 14:69548418-69548440 TTGCCCAGGCTGGTGGAGCAAGG - Intergenic
1119465999 14:74859148-74859170 TCTGCCAGGCAAATGGAGAGTGG - Intronic
1120401124 14:84033301-84033323 TCACCCTGGGTGATGGAGCAAGG + Intergenic
1120850380 14:89164154-89164176 CCTCCCAGACATAAGGAGCATGG - Intronic
1121047568 14:90799271-90799293 TGGCCCAGGCCGAGGGAGCAAGG - Intronic
1121466035 14:94116078-94116100 TCTCTGAGGGAGATGGAGGAGGG + Intronic
1121552011 14:94809984-94810006 TCTCCCAAGCAGATTGTCCATGG - Intergenic
1121559528 14:94864445-94864467 CCGCCCCGGCAGATAGAGCAGGG - Intergenic
1122545107 14:102517522-102517544 TCTCCTAGGGAGATGGGGCTCGG - Intergenic
1123476810 15:20596709-20596731 ACACCCAGGCAGATGGAGGCAGG - Intergenic
1123641201 15:22403655-22403677 ACACCCAGGCAGATGGAGGCAGG + Intergenic
1126283130 15:46979860-46979882 TCTCCCAGGATGATGCTGCAAGG - Intergenic
1127287735 15:57545743-57545765 TGTCTCAGGCTGAGGGAGCAAGG + Intronic
1127476481 15:59338673-59338695 TCCCACAGGCAGGAGGAGCAAGG + Intronic
1128519867 15:68368184-68368206 TCTCCCTGGGAGATGGGGGATGG - Intronic
1128865237 15:71110114-71110136 TCTCCAAGACAACTGGAGCAGGG - Intronic
1128883748 15:71266145-71266167 TCTCCCAGTCAGAAGGCACAGGG - Intronic
1129258064 15:74345415-74345437 TCTCCCAGCCAGGCAGAGCAGGG - Intronic
1129791928 15:78347025-78347047 TCTCACAGGCAGTTAGAACAGGG - Intronic
1131714794 15:95096691-95096713 TCTGCCAGGCAGAAGGGGAATGG - Intergenic
1132120579 15:99171961-99171983 TCTCCCAGGCACAAGGAGTTGGG - Intronic
1132638023 16:962904-962926 CCTCCAAGGCAGTGGGAGCAGGG + Intronic
1133331730 16:4979040-4979062 TCTCCAAGTCAGATGCAGGAAGG + Intronic
1134242824 16:12518382-12518404 ACCCCCAGGCAGAAGGAGCTTGG - Intronic
1134387007 16:13782593-13782615 GCTTCCAGGCAGAAGGAACAAGG - Intergenic
1134824592 16:17274443-17274465 ACTCCCTGACAGATGGGGCAGGG + Intronic
1135807626 16:25556828-25556850 TCTCCCAGTCAGGAGGCGCAAGG - Intergenic
1136283214 16:29226344-29226366 TCCTGCAGGGAGATGGAGCAGGG + Intergenic
1137009771 16:35310962-35310984 GCTCCCAGGGAGATGCAGCCAGG + Intergenic
1137646540 16:50080046-50080068 TCACTCAGGCAGCTGGAGGAAGG + Intronic
1138492216 16:57383209-57383231 TGTCCCTGGCAGGTGGAGAATGG - Exonic
1138496702 16:57413295-57413317 TCTCGGAGGCAGATAAAGCATGG + Intronic
1139418984 16:66836903-66836925 TCTCCAAGGCCGATCAAGCAAGG + Intronic
1139870943 16:70108220-70108242 TCTCCCAGCCAAATGGGTCAAGG - Intergenic
1140375932 16:74445653-74445675 TCTCCCAGCCAAATGGGTCAAGG + Intergenic
1140929836 16:79617293-79617315 TCTCCTAGGCACAGAGAGCAGGG + Intergenic
1141624754 16:85255226-85255248 TCTCCCAGGCAGCAGGAGTCGGG - Intergenic
1141657716 16:85424974-85424996 CATGCCAGGCAGCTGGAGCAGGG + Intergenic
1141717461 16:85735082-85735104 TCTGCCCTGCAGAGGGAGCAGGG - Intronic
1142087595 16:88192241-88192263 TCCTGCAGGGAGATGGAGCAGGG + Intergenic
1142170451 16:88619374-88619396 GCTTCCAGGCCCATGGAGCAAGG - Intronic
1142376182 16:89708203-89708225 TCTCCCAGACAGCAGGAGCTGGG - Intronic
1142506249 17:365030-365052 TTTCCCAGGCAGAAGAATCAGGG - Intronic
1142655138 17:1387231-1387253 TCTCCCATTCTGATGGAGCAGGG - Intronic
1144333997 17:14252930-14252952 TCTCCTAGGCAGATAGGGGAGGG + Intergenic
1148229176 17:45920541-45920563 GCTGCCAGGCAGAAGGTGCACGG - Intronic
1148597629 17:48869442-48869464 TCTCCCAGTCAGATGGGGAAAGG + Intergenic
1149614839 17:57988505-57988527 TGGCTCAGGCAGCTGGAGCAGGG + Intergenic
1149755738 17:59183978-59184000 TCTCCCAAGTAGTTGGAACAAGG - Intronic
1150090842 17:62323295-62323317 TCTCCCAGTCAGGAGGAACAGGG - Intergenic
1150652052 17:67016683-67016705 GCTCCCAGGCTGCAGGAGCAGGG + Intronic
1151268853 17:72977858-72977880 TCTCCCAGGCAGCTGGTGGCTGG - Intronic
1151417585 17:73976627-73976649 TATCCTAGGGAGATGGAGCAGGG + Intergenic
1152186839 17:78862462-78862484 TCTCCCTGGGAGGGGGAGCAGGG - Intronic
1152196931 17:78923909-78923931 TGTCCAGGGCAGATGGAGCAAGG - Intronic
1152449480 17:80367974-80367996 TCTCCCAGGCAGATGGAGCACGG - Exonic
1152582161 17:81170928-81170950 TCTTCCAGGCTGAGGCAGCAGGG + Intergenic
1154122943 18:11666298-11666320 TCTTCCAGGCAGAAAGACCAGGG + Intergenic
1155988759 18:32257579-32257601 TCTCCTAGGCAGATGGAGGAAGG - Intronic
1156306243 18:35880391-35880413 TCAACCAGGCAGATAGGGCAAGG + Intergenic
1156587567 18:38448247-38448269 TCTACCAGGGAAATGAAGCATGG - Intergenic
1157213570 18:45763804-45763826 TGTCCTAGGCACTTGGAGCATGG - Intergenic
1157369816 18:47100408-47100430 TCTCACCAGCAGATGGAGCCTGG + Intronic
1160162822 18:76488054-76488076 TCTCGGAGGCAGATGGAGGTGGG - Intronic
1160382791 18:78473626-78473648 TTTGTCAGGCAGCTGGAGCAAGG + Intergenic
1160540909 18:79621953-79621975 TCTTGCTGGCAGCTGGAGCAGGG - Intergenic
1161900317 19:7113865-7113887 TCTCCAGGGCAGGTGGAGAAAGG + Intronic
1163127205 19:15250798-15250820 TCTGCCAAGCACATGGGGCAGGG - Intronic
1164593282 19:29517793-29517815 TGGCCCAGGAAGATGGAGAAGGG + Intergenic
1166420714 19:42633915-42633937 TCCCCAAGGCTGATGCAGCAGGG + Intronic
1167135802 19:47614699-47614721 TCTCCCAGGGAGATGAAGCGTGG - Intronic
1168279595 19:55297698-55297720 TCGCTCAGGGAGAGGGAGCAGGG - Intronic
925838340 2:7966820-7966842 TCTCCCTGGCAGGTTGGGCAAGG - Intergenic
927157706 2:20231129-20231151 TACCGCAGGCAGATAGAGCAGGG + Intergenic
928125827 2:28615133-28615155 AGTCCCAGGCAGAAGGACCATGG + Intronic
928916156 2:36473288-36473310 TTTCACCGGCAGATTGAGCAGGG + Intronic
932335442 2:70928478-70928500 AGTCAGAGGCAGATGGAGCAGGG - Intronic
933262038 2:80141634-80141656 TCCACCAGTGAGATGGAGCAGGG + Intronic
933944953 2:87278281-87278303 TCTCCCAGAGACCTGGAGCAGGG + Intergenic
934654437 2:96109943-96109965 CCTCCCAGGGAGCTGGGGCAGGG + Intergenic
936335255 2:111583309-111583331 TCTCCCAGAGACCTGGAGCAGGG - Intergenic
936809176 2:116375605-116375627 TGTCCCAGGCAGAGAGAGAATGG - Intergenic
938624924 2:133097758-133097780 TCTCCCAGTCAGCTAGGGCAAGG - Intronic
939264499 2:139853683-139853705 TGTCCCAGGCAGAAGCTGCAAGG + Intergenic
939319611 2:140601241-140601263 TCTCTCAGGAAGATGAAGCCTGG + Intronic
940084207 2:149839568-149839590 TCTCCCAGTCAGGAGGAACAGGG + Intergenic
940835165 2:158513334-158513356 CCTCACAGGCAGATGCATCAGGG - Intronic
943283104 2:185963207-185963229 TCCCCCATGCAGAGGGAGGAAGG + Intergenic
943512378 2:188841312-188841334 TCTCCCAGTCAGGTGGCCCAGGG - Intergenic
944386392 2:199169714-199169736 TCTCCCAAGCACATGGGCCAAGG - Intergenic
944682878 2:202092755-202092777 TCTCCCTGGTGGAAGGAGCATGG - Intronic
945389066 2:209242115-209242137 TCTCCCAGTCAGAAGGCACAGGG - Intergenic
946178800 2:217937837-217937859 TCTCCCACCCAGATGGACCCAGG + Intronic
946677116 2:222171864-222171886 TCACCCAGACACATGGAACATGG + Intergenic
947182493 2:227423886-227423908 TTTCCCAGGCAGATGCAGGAGGG + Intergenic
948377279 2:237529846-237529868 TCTCCCAGGAGGAGGGAGGAGGG - Intronic
948408718 2:237742754-237742776 CCTCCCAGGCAGAAGGACCGGGG - Intronic
948502963 2:238408373-238408395 GCCCCCAGGCAGATGGAGCCTGG + Intergenic
1169001640 20:2172228-2172250 GGTTCCAGGCAGAGGGAGCAGGG - Intronic
1169456100 20:5753877-5753899 TCTCCCATGCAGAGGGAGGGGGG - Intronic
1169924030 20:10764826-10764848 TCTGGCAGGCAGATGAGGCAGGG + Intergenic
1170122443 20:12925694-12925716 TCTCCCAGGAAGGTGGATAAAGG + Intergenic
1170244515 20:14205679-14205701 TCTCCTAGGCAGATAGGGCAGGG - Intronic
1170346887 20:15397077-15397099 TTTCCCAGTCAGATGGCTCAAGG + Intronic
1171425585 20:25046684-25046706 GTTCGCAGGCAGATGGAGCTGGG + Intronic
1172514125 20:35521423-35521445 CATTCCAGGCAGAGGGAGCAAGG + Intergenic
1173264896 20:41470187-41470209 TCTCCCACAGAGATGGAGCAAGG - Intronic
1174088368 20:48026626-48026648 TCTCCCAGGAAGATGGGCAAAGG + Intergenic
1174304396 20:49604806-49604828 TCCCCCATGCAGATGAAGAACGG - Intergenic
1175204694 20:57302654-57302676 TCTCCGAGGCAGCTGCAGCCAGG + Intergenic
1175572214 20:60032347-60032369 TCTCCCTGGCAAATAGATCATGG - Intronic
1175904709 20:62374025-62374047 CCTCCCGGGCAGAGGGCGCAAGG - Intergenic
1176139590 20:63539142-63539164 TCTCCCATGCAGATGGAGCTGGG + Intergenic
1176370600 21:6059695-6059717 TCTCCCAGGCTGCTGCAGCATGG + Intergenic
1177406413 21:20673730-20673752 TATCCAAGGCACATGGTGCAAGG - Intergenic
1177796364 21:25782593-25782615 GCTTCCAGGAAGAAGGAGCATGG - Intergenic
1178121388 21:29473719-29473741 GCTCACAGACAGAGGGAGCAGGG - Intronic
1178350506 21:31870021-31870043 TCTCCCAGCCATATGGGGCGAGG + Intergenic
1178493902 21:33071125-33071147 TCTCCCAGACGCAGGGAGCAGGG - Exonic
1179168885 21:38957628-38957650 TCCCCCAGGCTTATGGAGCATGG + Intergenic
1179657699 21:42855376-42855398 TCTGCCAGCCAGGTGGGGCAGGG - Intronic
1179688726 21:43068281-43068303 ACTCCCCAGCAGATGGACCAGGG - Intronic
1179752919 21:43478846-43478868 TCTCCCAGGCTGCTGCAGCATGG - Intergenic
1179936723 21:44610705-44610727 TTTTCCAGGCACATGGTGCAAGG - Intronic
1182749973 22:32633589-32633611 CCTCCGAGGCAGAGGGAGCAAGG + Intronic
1183021427 22:35030396-35030418 TCTCCCAGTCAGGAGGCGCAGGG + Intergenic
1183077846 22:35438054-35438076 TCTTCCAGGCAGAAGGACCCAGG + Intergenic
1183460516 22:37947235-37947257 TCCCCCAGGGAGATGGAGAAAGG + Intronic
1183724417 22:39580585-39580607 TTTTCCAGGCAGAGGGAACACGG + Intronic
1183948683 22:41340716-41340738 CCTGCCAGGCAGAGGAAGCAGGG + Intronic
1184558726 22:45248693-45248715 TCTCATTGACAGATGGAGCAGGG - Intergenic
1184943450 22:47784749-47784771 TTTCCCAAGCAGATGGTGGAAGG + Intergenic
1185083588 22:48723612-48723634 TCTTCCAGGCAGGGGGAGGATGG - Intronic
950405528 3:12801966-12801988 TCTGCCAAACAGATGGAGGAGGG - Intronic
950787648 3:15449684-15449706 TTTCCCAGGTACCTGGAGCATGG + Intronic
952045331 3:29312039-29312061 TCTACCATGCAGATGGACTATGG - Intronic
953376664 3:42434472-42434494 TCTTTCAGGAAGATGGAACAGGG - Intergenic
954624535 3:52015418-52015440 TGTCCCAGGCAGAAGGAACAGGG - Intergenic
961084794 3:124057625-124057647 ACTCCCAAGCAGAAGGAGCCTGG + Intergenic
965588470 3:170340663-170340685 TCTCCCAGGTACATAGAGAAAGG + Intergenic
965937447 3:174131992-174132014 TATCCAAGGCAGATGAAACAAGG - Intronic
966925282 3:184640553-184640575 TGTCCCAGGGAGATGGGGTAGGG - Intronic
967186698 3:186950196-186950218 TCTGCCAGGCAGTTGGGGCGGGG + Intronic
967276808 3:187784263-187784285 TGTCCCAGACAGAGGGAACATGG + Intergenic
967984381 3:195084412-195084434 TCACCCAGGAAAATGGAGCATGG + Intronic
968756879 4:2420962-2420984 CCTCCCTGGCAGCTGGGGCATGG - Intronic
968947000 4:3670414-3670436 TCTCACAGGCTGATGGTGCCTGG - Intergenic
969241939 4:5904712-5904734 TTTCCTAGGGAGAAGGAGCATGG - Intronic
969900899 4:10348294-10348316 CATCCCAGGAAGATGGAGTAGGG - Intergenic
972419082 4:38869342-38869364 TTTGCCAGGCAGCTGGAGGAAGG + Intronic
974223243 4:59003465-59003487 TCCCCCATGCAGAGGGAGGAGGG - Intergenic
974468814 4:62292778-62292800 TCTCCCATGCAGAGGAGGCAGGG - Intergenic
975850476 4:78566764-78566786 TCTTACATGCAGATGGTGCATGG - Intronic
975944500 4:79688817-79688839 GTTCTCAGGCAGATGTAGCAAGG + Intergenic
976061188 4:81130443-81130465 TCTCCCCGGCAGGAGGAACAAGG + Intronic
976352752 4:84078740-84078762 AATCACAGGTAGATGGAGCAAGG + Intergenic
977154545 4:93555793-93555815 TCTCCCAGGCAGGAGGCACAAGG - Intronic
980179023 4:129381616-129381638 TCTCTGAGGCAGGGGGAGCAAGG + Intergenic
981133919 4:141189351-141189373 TCTCCCAGTCAGGTGGCACAGGG + Intronic
981794880 4:148585048-148585070 TCTCCCAGTCAGAAGGCACAGGG + Intergenic
982065076 4:151647335-151647357 TCTGGCAGGCAGCTAGAGCAAGG + Intronic
982161964 4:152579339-152579361 TCTCCCAAGCAGATTGCACAAGG - Intergenic
984336500 4:178399548-178399570 GCACCCAGGCTGATGGAGCATGG - Intergenic
984449339 4:179878976-179878998 TCTTCCAGACAAATGGAGCTCGG + Intergenic
985551198 5:534477-534499 TCTCCCAGCCCGGTGGACCACGG + Intergenic
985876929 5:2606994-2607016 CACACCAGGCAGATGGAGCAGGG - Intergenic
986104843 5:4649937-4649959 TCTGCATGGCAGATGGTGCAGGG - Intergenic
987116457 5:14730219-14730241 TCTCCCCAGAAGCTGGAGCAGGG + Intronic
988903282 5:35756776-35756798 TCTCCCAGGGAGAGGGAAGAAGG - Intronic
990739734 5:58900188-58900210 TCTCCCATGCAGCTGGAGGATGG - Intergenic
991149009 5:63344441-63344463 TATCCCAGGGAGATGGAGAGTGG + Intergenic
992435328 5:76750659-76750681 TCTGCCAGGCACATGGGACATGG + Intergenic
993460088 5:88172599-88172621 TCTCCCAGTCAGAAGGCACAGGG + Intergenic
998463887 5:142327755-142327777 CATCTCAGGCAGAGGGAGCATGG + Intergenic
999277191 5:150339105-150339127 TCCCCCAGGCAGAGGGAGAGGGG - Intronic
999638249 5:153644835-153644857 TCTCCCATGCAGAATGAGCTTGG + Intronic
1000353840 5:160374247-160374269 GGTGCCAGGCAGAAGGAGCAGGG + Intergenic
1001206140 5:169764912-169764934 TCTTCCAGGCATATGTAACATGG - Intronic
1001400725 5:171444985-171445007 GCTCTCAGGAAAATGGAGCAGGG + Intronic
1001735801 5:173999151-173999173 TCTCCCAGGCAACTGGAAAATGG + Intronic
1002087558 5:176785442-176785464 TCACCCAGCCAGATGGAGGCAGG - Intergenic
1002210170 5:177594079-177594101 TCTGGCAGGAAGATGGAGCAGGG + Intronic
1003092248 6:3114110-3114132 TTTCCCAGGCAGTTGTTGCAAGG + Exonic
1003303253 6:4903870-4903892 TCTCCCAGGCAGACGGCTGATGG - Intronic
1004466024 6:15885736-15885758 ATTCTCAGGCAGGTGGAGCACGG - Intergenic
1005153786 6:22780706-22780728 TCTTCCAAGCAGAAGGAGGAAGG - Intergenic
1005827337 6:29641973-29641995 ACGCCCAGGCAGAGGGAGCTGGG - Intergenic
1005952611 6:30642845-30642867 TTTCCCAGGCTGCTGGAGCGGGG - Exonic
1006499829 6:34451056-34451078 TTTCCCTGGCAGACAGAGCAAGG + Intergenic
1008568635 6:52793468-52793490 GATCCCAGGGAGATAGAGCAGGG - Intronic
1012676514 6:102119799-102119821 TTTCCTAGGCAGACGGGGCAGGG - Intergenic
1013146688 6:107400841-107400863 TCTCTAAGGCAGTTGGGGCAGGG - Intronic
1013561149 6:111306270-111306292 TGTTCCTGGCAGAAGGAGCAGGG + Intronic
1014058422 6:117043545-117043567 TCTCCCAGTCAGGTGGCACAGGG + Intergenic
1014432097 6:121382975-121382997 ACTTCCAGGCAGATGAATCAGGG - Intergenic
1017600644 6:156077101-156077123 GCTCGCAGACAGAAGGAGCAGGG + Intergenic
1017656444 6:156633975-156633997 GTACCCTGGCAGATGGAGCAAGG + Intergenic
1017760297 6:157563084-157563106 TCTCCCAGGCACCCGGAGCTGGG + Intronic
1017908261 6:158771555-158771577 TCTCCAGGACAGATGGAGGAAGG + Intronic
1018836950 6:167492327-167492349 TCTCTCAGGCAGTGGGAGGATGG + Intergenic
1018909777 6:168095335-168095357 CCTCCCAGGCAGCGGGAGCATGG + Intergenic
1019708584 7:2508054-2508076 TCTCCAGAGCAGGTGGAGCAAGG - Intergenic
1020218850 7:6218406-6218428 TCTCTCCTCCAGATGGAGCACGG + Intronic
1021392754 7:20114456-20114478 TTTCCCAGGCAGGTGGATCTAGG - Intergenic
1021416604 7:20393461-20393483 TCTGGCAGCCAGATGGAGGATGG - Intronic
1021799959 7:24295380-24295402 TCTCCCATGCAGAGGGAGACAGG + Intergenic
1023686700 7:42743215-42743237 TCTACCAGCCACAAGGAGCAGGG + Intergenic
1025022463 7:55490316-55490338 TCTCCCAGACAGATGGAGCGGGG + Intronic
1026583819 7:71639570-71639592 TCTCCATGGCAGAGGTAGCAGGG - Intronic
1026896072 7:74010745-74010767 TTTCCCAGGCAGGTGGTGCAGGG - Intergenic
1028649795 7:93138765-93138787 ACTCCAGGGCAGATGGAGCTTGG + Intronic
1029152614 7:98491655-98491677 ACACCCAGACAGATGGAGCAGGG - Intergenic
1029523186 7:101077484-101077506 TGTGCCAGGCAGCTGGAGAAGGG - Intergenic
1029695927 7:102213202-102213224 TGTCCCTTGCAGATGGTGCAGGG + Intronic
1030114376 7:106051911-106051933 TCTCCTAGGCAGATAGGGGAGGG - Intergenic
1032477739 7:132223887-132223909 TATCCCATGGAGATGGAGGAGGG - Intronic
1034036340 7:147827251-147827273 TGCCCCAAGCAGATGGAGTAAGG + Intronic
1038048758 8:23789769-23789791 TCTCCCAGGCAGACGGCCCCTGG + Intergenic
1038512437 8:28151836-28151858 TCTCCCAGCCAGAAGCAGAAGGG + Intronic
1039367046 8:36939787-36939809 ACTCCCAGGCAGAAGTAGGAGGG + Intergenic
1039903699 8:41770938-41770960 TCTCCCAGGCAGAGACAGCTTGG + Intronic
1040473797 8:47759578-47759600 TCTCCCAGTCAGAAGGCACAGGG + Intergenic
1041933838 8:63315270-63315292 TCTCCCAGGCAGATATTTCATGG - Intergenic
1044016578 8:87053738-87053760 TCTCCCAGGTATATGGATCCTGG + Intronic
1046781538 8:118220889-118220911 TCTCTCAGGCAGTTGGCACAAGG - Intronic
1046869204 8:119186193-119186215 TCTCCCAGGCAGATGCAACCAGG + Intronic
1047615940 8:126562571-126562593 CATCCCAGGCAGATGGAGGCTGG + Intergenic
1049324674 8:142015785-142015807 TCTCCCAGGCATCTTGAGCCTGG - Intergenic
1049478728 8:142809997-142810019 TCCCCCAGGCAGAGGAAGCCAGG - Intergenic
1049664133 8:143835557-143835579 GCTCCCAGGCGCATGGAGGAGGG + Exonic
1051788323 9:20771356-20771378 TCTCGTAGGAAGATGGAGGAGGG + Intronic
1052381253 9:27773395-27773417 ACTCCCAGCCAGACTGAGCATGG - Intergenic
1056678240 9:88695112-88695134 CCTCCAAGGAAGATGGAGCAGGG - Intergenic
1057013569 9:91630545-91630567 ACTTCCAGTCAGCTGGAGCAAGG + Intronic
1058822751 9:108747740-108747762 CATCCCAGGCAGGTGGAACACGG - Intergenic
1059006394 9:110407485-110407507 TCTGCCAGGAAGATGGAACTTGG - Exonic
1059024078 9:110605668-110605690 TCTCCAACGCATCTGGAGCATGG + Intergenic
1059281364 9:113136743-113136765 TCTCCCATGCACATGGAGAGGGG - Intergenic
1060948909 9:127588178-127588200 TGTTCCAGGCAGAGGGAACAGGG - Intergenic
1061224935 9:129275920-129275942 TCTGCCAGGTGGATGGAGGAGGG - Intergenic
1061510985 9:131060902-131060924 TTTCCCAGGCAGAGGCAGCAAGG - Intronic
1061709616 9:132478625-132478647 TCTCCAAGGCAGATGGGGCCCGG + Intronic
1186103587 X:6182290-6182312 TTCCCAAGGGAGATGGAGCAAGG + Intronic
1186770592 X:12814301-12814323 TTTTCCTGGCAGAGGGAGCAGGG - Intronic
1187136576 X:16552975-16552997 CCTCCCAGGTAGCTGGAACATGG - Intergenic
1187423231 X:19154819-19154841 ATAACCAGGCAGATGGAGCAGGG + Intergenic
1190309960 X:49110194-49110216 TCTCCCAGGCTGATTGTGCAGGG - Intergenic
1191720177 X:64222711-64222733 TCTCTCAGGCAGAAGTAGCTAGG + Intergenic
1192590452 X:72355311-72355333 ATTCCCAGACAGGTGGAGCAGGG + Intronic
1193394541 X:80968290-80968312 TCTCCCAGTCAGGAGGAACAGGG - Intergenic
1193780994 X:85701249-85701271 TCTCTCAGGGAGAAGGAGGAGGG - Intergenic
1196133462 X:112181868-112181890 TCTCCCAGTCAGGAGGAGCACGG - Intergenic
1196769990 X:119283594-119283616 TCTACCAGGCAGCTTGGGCAGGG - Intergenic
1201221355 Y:11773817-11773839 TCTCCTAGGCAGATAGGGGAGGG - Intergenic
1201678801 Y:16619492-16619514 AGTCCAAGGCAGGTGGAGCAAGG + Intergenic