ID: 1152450805

View in Genome Browser
Species Human (GRCh38)
Location 17:80378374-80378396
Sequence TACTGTGTATGGAGGGCTCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 136
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 125}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152450805_1152450809 -1 Left 1152450805 17:80378374-80378396 CCTAGAGCCCTCCATACACAGTA 0: 1
1: 0
2: 1
3: 9
4: 125
Right 1152450809 17:80378396-80378418 ATCTGTACTTGCTGAGCAAGAGG 0: 1
1: 0
2: 0
3: 9
4: 146
1152450805_1152450812 7 Left 1152450805 17:80378374-80378396 CCTAGAGCCCTCCATACACAGTA 0: 1
1: 0
2: 1
3: 9
4: 125
Right 1152450812 17:80378404-80378426 TTGCTGAGCAAGAGGCTGGTGGG 0: 1
1: 0
2: 0
3: 21
4: 186
1152450805_1152450810 3 Left 1152450805 17:80378374-80378396 CCTAGAGCCCTCCATACACAGTA 0: 1
1: 0
2: 1
3: 9
4: 125
Right 1152450810 17:80378400-80378422 GTACTTGCTGAGCAAGAGGCTGG 0: 1
1: 0
2: 0
3: 7
4: 161
1152450805_1152450811 6 Left 1152450805 17:80378374-80378396 CCTAGAGCCCTCCATACACAGTA 0: 1
1: 0
2: 1
3: 9
4: 125
Right 1152450811 17:80378403-80378425 CTTGCTGAGCAAGAGGCTGGTGG 0: 1
1: 0
2: 1
3: 24
4: 296
1152450805_1152450813 23 Left 1152450805 17:80378374-80378396 CCTAGAGCCCTCCATACACAGTA 0: 1
1: 0
2: 1
3: 9
4: 125
Right 1152450813 17:80378420-80378442 TGGTGGGTTGAGCTGACACGTGG 0: 1
1: 0
2: 2
3: 7
4: 77

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152450805 Original CRISPR TACTGTGTATGGAGGGCTCT AGG (reversed) Intronic
904445531 1:30570625-30570647 TCCCCTGTGTGGAGGGCTCTGGG + Intergenic
905089652 1:35419028-35419050 TAATGTGTATTGAGTGCCCTTGG + Intronic
906308220 1:44734901-44734923 TACTGTGTATCCTGGGTTCTGGG - Intergenic
907487258 1:54786693-54786715 TACTGTGAATGAAGGTCTCAAGG + Intronic
908110142 1:60888585-60888607 AACTGTGCATTGAGGGATCTAGG - Intronic
910716419 1:90236118-90236140 TACTGGTTATTCAGGGCTCTAGG + Intergenic
911611516 1:99963451-99963473 TCCTGTGTATAGAGGGCTGTAGG + Intergenic
916586813 1:166156439-166156461 GACTCAGTATGGAGGGCACTGGG + Intronic
920199856 1:204252854-204252876 TACTGTGCATGGATGGCTCCTGG - Intronic
920365805 1:205447846-205447868 TTCTGTGTAAGGAGACCTCTGGG - Intronic
1062785423 10:260758-260780 TCCTGTGTTTGAAGGGATCTGGG - Intergenic
1065954563 10:30682481-30682503 TCATGTGCATGAAGGGCTCTGGG + Intergenic
1067224509 10:44366916-44366938 TGCTGTGAATGGAGGGGCCTGGG - Intergenic
1070978305 10:80623418-80623440 TAGTGAGGATGGAGGGCTCATGG - Intronic
1075550737 10:123390732-123390754 TTCTGTTTAGGGAGGTCTCTTGG + Intergenic
1078026285 11:7698643-7698665 TACTGAGCAGGGAGCGCTCTTGG + Intronic
1078596134 11:12688252-12688274 TCCTGATTATGAAGGGCTCTGGG - Intronic
1080908051 11:36566586-36566608 CATTGTGTAAGGAGGGCTCAGGG + Intronic
1085753465 11:79184359-79184381 AACTGAGCATGGAGGGATCTAGG - Intronic
1086437766 11:86799580-86799602 TACTGTGTATTGAGCGTTTTCGG - Intronic
1086814668 11:91354438-91354460 TACTGTGTTTTGAGGTCACTTGG - Intergenic
1089016233 11:115167601-115167623 CAGTGTGTTTGGAGGGCTCCGGG - Intergenic
1089339350 11:117746992-117747014 TACCACTTATGGAGGGCTCTCGG - Intronic
1091415142 12:276368-276390 TGCTGTGTATGGAGGGATAAAGG + Intergenic
1091671581 12:2456010-2456032 TACTGTGTCTGGAGGTCAGTGGG - Intronic
1092283061 12:7111922-7111944 AACTATGCATGGAGGGATCTAGG + Intergenic
1094307958 12:29042147-29042169 TACCATGTGTGGAGGGCTGTGGG + Intergenic
1094492855 12:30972064-30972086 TAGTTTTTATGGAGGACTCTGGG + Intronic
1099092429 12:78330114-78330136 GACTGTTTATGGAGAGATCTGGG - Intergenic
1101748572 12:107563654-107563676 TTGTGGTTATGGAGGGCTCTTGG + Intronic
1106183504 13:27387974-27387996 TTCTGTGTGAGGAGGGCTCAGGG - Intergenic
1107295177 13:38900249-38900271 TCCTGTGGATGGAGGCCTCTTGG + Intergenic
1108169165 13:47723606-47723628 TGCTGTGTATGTAGGACTTTCGG - Intergenic
1108451007 13:50562784-50562806 TACTGTTTATGCCGGGCGCTTGG + Intronic
1110026008 13:70540256-70540278 TACTTTGTGGGGAGGCCTCTTGG - Intergenic
1110372862 13:74758877-74758899 TTCTGTGTAGGTTGGGCTCTTGG - Intergenic
1112114032 13:96333520-96333542 TGGTTTGTATGGAGGGCTTTGGG + Intronic
1112308829 13:98300091-98300113 TTCTGTGTGTGGTTGGCTCTTGG - Intronic
1116400227 14:44497401-44497423 TATTGTGTGAGGAGGCCTCTGGG - Intergenic
1118326475 14:64784897-64784919 TACTGTCAATGGAGGGACCTGGG + Intronic
1121722859 14:96123360-96123382 TACTGCGTTTTGAGGGTTCTTGG - Intergenic
1124401860 15:29355303-29355325 TACTGAGTATGAAGTGCTCCAGG + Intronic
1124493486 15:30172601-30172623 TAGTGTGTAATGTGGGCTCTAGG + Intergenic
1124750048 15:32365724-32365746 TAGTGTGTAATGTGGGCTCTAGG - Intergenic
1127299887 15:57642865-57642887 TACTATGTAGGAAGGGCTCATGG + Intronic
1127962704 15:63901663-63901685 GACTCTGGATGGAGGGCTCCTGG - Intergenic
1131756096 15:95564179-95564201 TCCTGTGGATGGAGGGCCCGTGG + Intergenic
1132138437 15:99367765-99367787 GACTGGGTTTGGAGAGCTCTGGG - Intronic
1132788393 16:1670958-1670980 TACTGAGAATGGAGAGATCTGGG + Intronic
1136548891 16:30971279-30971301 TGCTGTGGATGCTGGGCTCTGGG - Intronic
1137854439 16:51779606-51779628 TACTGTTTTTAGAGGGCACTTGG + Intergenic
1138596639 16:58032719-58032741 GTCTTGGTATGGAGGGCTCTAGG - Intronic
1141717379 16:85734683-85734705 TCCTGTGTGTGGATGGCCCTGGG - Intronic
1144175066 17:12697178-12697200 TCCTTGGCATGGAGGGCTCTTGG + Intronic
1148102150 17:45098756-45098778 TGCCTTGTCTGGAGGGCTCTTGG + Intronic
1152058701 17:78052344-78052366 CACTGTGTATGGTGATCTCTGGG - Intronic
1152450805 17:80378374-80378396 TACTGTGTATGGAGGGCTCTAGG - Intronic
1153446381 18:5177576-5177598 TACTTTGTTTAGAGGGTTCTGGG - Intronic
1155087424 18:22471934-22471956 CACTGTGTCTGAAGGGCACTGGG - Intergenic
1157404615 18:47412507-47412529 AAGTGTGTATGGAGGGCGCAGGG - Intergenic
1157890487 18:51411333-51411355 AGCTGTGTAGGGAGGGCTGTGGG + Intergenic
1158468477 18:57712964-57712986 TACTGTTTATTCAGGGCTCAAGG - Intronic
1160208583 18:76857997-76858019 TATTGTGTAGGGAGGTCTTTTGG + Intronic
1160416581 18:78716292-78716314 TGCTGTGTGTGGAGGCCTCTGGG - Intergenic
925104428 2:1278389-1278411 TGCTGTTTATGGAGGGCACCAGG + Intronic
925844056 2:8020049-8020071 CACTGTCTGTGGAGGGCTCCCGG + Intergenic
927142453 2:20139736-20139758 TATTGGGGGTGGAGGGCTCTGGG - Intergenic
932136825 2:69238684-69238706 TACCTTGTTTGGAGGGCTGTAGG - Intronic
933542378 2:83663519-83663541 TGGTATGTATGGAGGGGTCTTGG + Intergenic
935795603 2:106638211-106638233 TACTTTGTATGCAGAGCACTAGG + Intergenic
937696956 2:124818748-124818770 TGCTGTGAATGGATAGCTCTGGG - Intronic
940991823 2:160104954-160104976 TATTGTCTCTGGAGGGCACTGGG + Intronic
942057261 2:172196096-172196118 CACTGGGTATGGACGCCTCTGGG + Intergenic
942933146 2:181520699-181520721 TGTTGTGAATAGAGGGCTCTGGG - Intronic
943008178 2:182412305-182412327 TACTGTTTAGGGTGGGATCTTGG - Intronic
943906738 2:193508614-193508636 AACTGTGTGTCGAGGGATCTAGG + Intergenic
944862301 2:203826493-203826515 TTCTGAGTATGCAGGGCCCTGGG + Intergenic
947318392 2:228889925-228889947 GGCTGTGTCTGGAGGGCGCTGGG - Intronic
948585396 2:239015863-239015885 TGGTGTGTATGTGGGGCTCTTGG - Intergenic
1169351836 20:4874182-4874204 TACTGACTGTGGTGGGCTCTGGG - Intronic
1173263101 20:41453712-41453734 TACTGTGTGTGCAGGACACTGGG - Intronic
1173628965 20:44495663-44495685 TACTGTGTAAGGAGGGGGCAGGG - Intergenic
1173727204 20:45306515-45306537 TTGTGTGTGTGGAGGGGTCTGGG - Intronic
1174090367 20:48042215-48042237 TACTGGGCGTGGAGGGTTCTAGG - Intergenic
1178134034 21:29605890-29605912 CATTGTGTATGGAAGGCTCATGG + Intronic
949784671 3:7727847-7727869 GACTGTGTATGTTGGGATCTTGG - Intronic
956058379 3:65324773-65324795 TCCTGAGTAGGGAGGGCTCCTGG - Intergenic
961231299 3:125313511-125313533 TACTGTGTCTGGAGAGCTACAGG - Exonic
963945579 3:151142549-151142571 AACTATGTAAGGAGGGGTCTGGG - Intronic
972231465 4:37077231-37077253 TACTGTTTGTTGAAGGCTCTGGG - Intergenic
981921121 4:150085745-150085767 TGGTGTGTAGTGAGGGCTCTTGG - Intronic
991028222 5:62053166-62053188 TACTGTTTATTGAGTGCTCCTGG - Intergenic
991289691 5:65021346-65021368 TACTGAGAATGGAGAGGTCTAGG - Intergenic
991666021 5:69000686-69000708 TCATGTGTATCAAGGGCTCTCGG + Intergenic
992122784 5:73611572-73611594 TACTGTGGATGCTGGGCACTAGG + Intergenic
993001435 5:82385157-82385179 GACAGTGAATGGAGGGCACTTGG + Intronic
994943782 5:106359229-106359251 AGCTGTGCATGGAGGGATCTAGG + Intergenic
996482485 5:123990696-123990718 TACCGTGTATGGAGGCTTCTTGG + Intergenic
996543595 5:124654563-124654585 AACTGTGTATGCAGTGCTGTGGG - Intronic
998830482 5:146152493-146152515 AACTGTGCATGGAGGGATCTAGG + Intronic
1000954076 5:167521536-167521558 CACTGTGTCTGGTGGGATCTTGG + Intronic
1000988690 5:167889305-167889327 CACTGTGGACGGAGGGCTGTGGG + Intronic
1003160799 6:3632735-3632757 TGCTGTGTCAGGAGAGCTCTTGG + Intergenic
1007020751 6:38518421-38518443 AATTGTGTATGGAGATCTCTAGG + Intronic
1007553088 6:42745278-42745300 TACTGTGTATGCGGAGCTGTTGG + Exonic
1008192902 6:48481954-48481976 AACTGAGTATGGAGGGATCTAGG - Intergenic
1008466003 6:51831669-51831691 TAATGTGTAGGGAGAGCTGTGGG - Intronic
1010024841 6:71203198-71203220 TATAGTATATGCAGGGCTCTGGG - Intergenic
1017399257 6:154040144-154040166 TACTGAGCAAAGAGGGCTCTTGG + Intronic
1019104792 6:169659587-169659609 GGCTGTGTGTGGTGGGCTCTGGG - Intronic
1019104797 6:169659608-169659630 GACTGTGTGTGGTGGGCTCTGGG - Intronic
1019709610 7:2512152-2512174 TTCTGTGCATGGGGGGCTGTGGG + Intergenic
1027200852 7:76063120-76063142 TTCTGTGTAGGGAGGAGTCTGGG + Intronic
1029726673 7:102410550-102410572 TACTGTGGCAGGGGGGCTCTTGG + Intronic
1029848730 7:103440971-103440993 CACTGTGTATGGAAGGCTGCAGG + Intronic
1032265524 7:130367659-130367681 TACTCTGAATGCAGGGGTCTGGG + Intronic
1034790259 7:153961796-153961818 TACTGTGAACTGAGGGATCTAGG - Intronic
1035361445 7:158316293-158316315 GACTGTGAAGTGAGGGCTCTTGG - Intronic
1036978345 8:13440671-13440693 TCCCATGTATGGAGGGATCTAGG + Intronic
1037281962 8:17251191-17251213 TACTGTGGAAGCAGGACTCTTGG + Intronic
1042143893 8:65707386-65707408 TACTGTGTATAGAAGCCACTGGG - Intronic
1046299582 8:112269579-112269601 CTCTGTGTATGATGGGCTCTAGG + Intronic
1046441756 8:114264861-114264883 TACTGTGTAGTGAGGGTTTTGGG + Intergenic
1047100017 8:121666486-121666508 TAGTGTGTCTGGTGGGTTCTTGG + Intergenic
1049623081 8:143607346-143607368 CACTGGGGATGGAGGGCTCAGGG - Intronic
1053021963 9:34701354-34701376 AACTGTGTCTGTGGGGCTCTGGG + Intergenic
1055149626 9:72980720-72980742 TATTGTGTATGCTGGGCTTTGGG + Intronic
1057439401 9:95072086-95072108 CACTGTGTATGTTGTGCTCTGGG + Intronic
1058126804 9:101204637-101204659 AACTGGGTCTTGAGGGCTCTGGG + Intronic
1060555859 9:124506929-124506951 GAGTGTGTCTGGAGGGCTCTGGG - Intronic
1060997630 9:127884134-127884156 TACTGTGTCTGGCGGCCCCTGGG + Intergenic
1062056766 9:134472889-134472911 TCCTGTGTATGCATGGCCCTGGG + Intergenic
1187630359 X:21162656-21162678 TAATGTGTATGGAGGCCTCTTGG + Intergenic
1189019412 X:37318998-37319020 CACTGTGTAGAGAGGGCTCACGG - Intergenic
1192314492 X:70041441-70041463 TACTCTGTTTTGAAGGCTCTGGG - Exonic
1199440123 X:147858166-147858188 AACTGTGCATGGAGGAATCTAGG + Intergenic