ID: 1152455447

View in Genome Browser
Species Human (GRCh38)
Location 17:80413508-80413530
Sequence CTTTCCCACCAGAGTGTAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152455447_1152455450 -8 Left 1152455447 17:80413508-80413530 CCTGCTACACTCTGGTGGGAAAG No data
Right 1152455450 17:80413523-80413545 TGGGAAAGACACCGCAGCAGGGG No data
1152455447_1152455448 -10 Left 1152455447 17:80413508-80413530 CCTGCTACACTCTGGTGGGAAAG No data
Right 1152455448 17:80413521-80413543 GGTGGGAAAGACACCGCAGCAGG No data
1152455447_1152455449 -9 Left 1152455447 17:80413508-80413530 CCTGCTACACTCTGGTGGGAAAG No data
Right 1152455449 17:80413522-80413544 GTGGGAAAGACACCGCAGCAGGG No data
1152455447_1152455451 -2 Left 1152455447 17:80413508-80413530 CCTGCTACACTCTGGTGGGAAAG No data
Right 1152455451 17:80413529-80413551 AGACACCGCAGCAGGGGAGCAGG No data
1152455447_1152455452 -1 Left 1152455447 17:80413508-80413530 CCTGCTACACTCTGGTGGGAAAG No data
Right 1152455452 17:80413530-80413552 GACACCGCAGCAGGGGAGCAGGG No data
1152455447_1152455457 17 Left 1152455447 17:80413508-80413530 CCTGCTACACTCTGGTGGGAAAG No data
Right 1152455457 17:80413548-80413570 CAGGGTGCGCAGGGTGCAGTGGG No data
1152455447_1152455455 8 Left 1152455447 17:80413508-80413530 CCTGCTACACTCTGGTGGGAAAG No data
Right 1152455455 17:80413539-80413561 GCAGGGGAGCAGGGTGCGCAGGG No data
1152455447_1152455456 16 Left 1152455447 17:80413508-80413530 CCTGCTACACTCTGGTGGGAAAG No data
Right 1152455456 17:80413547-80413569 GCAGGGTGCGCAGGGTGCAGTGG No data
1152455447_1152455454 7 Left 1152455447 17:80413508-80413530 CCTGCTACACTCTGGTGGGAAAG No data
Right 1152455454 17:80413538-80413560 AGCAGGGGAGCAGGGTGCGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152455447 Original CRISPR CTTTCCCACCAGAGTGTAGC AGG (reversed) Intergenic
No off target data available for this crispr