ID: 1152455448

View in Genome Browser
Species Human (GRCh38)
Location 17:80413521-80413543
Sequence GGTGGGAAAGACACCGCAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152455447_1152455448 -10 Left 1152455447 17:80413508-80413530 CCTGCTACACTCTGGTGGGAAAG No data
Right 1152455448 17:80413521-80413543 GGTGGGAAAGACACCGCAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152455448 Original CRISPR GGTGGGAAAGACACCGCAGC AGG Intergenic
No off target data available for this crispr