ID: 1152456830

View in Genome Browser
Species Human (GRCh38)
Location 17:80421636-80421658
Sequence AGATGTACCCTGCAAATTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 104
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 94}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152456830_1152456842 28 Left 1152456830 17:80421636-80421658 CCACCAATTTGCAGGGTACATCT 0: 1
1: 0
2: 1
3: 8
4: 94
Right 1152456842 17:80421687-80421709 TCATAGGTGAGGCAGGGAAGGGG 0: 1
1: 0
2: 1
3: 34
4: 341
1152456830_1152456833 12 Left 1152456830 17:80421636-80421658 CCACCAATTTGCAGGGTACATCT 0: 1
1: 0
2: 1
3: 8
4: 94
Right 1152456833 17:80421671-80421693 TTCCAAACCCATCATCTCATAGG 0: 1
1: 0
2: 1
3: 10
4: 176
1152456830_1152456840 26 Left 1152456830 17:80421636-80421658 CCACCAATTTGCAGGGTACATCT 0: 1
1: 0
2: 1
3: 8
4: 94
Right 1152456840 17:80421685-80421707 TCTCATAGGTGAGGCAGGGAAGG 0: 1
1: 0
2: 1
3: 31
4: 291
1152456830_1152456835 17 Left 1152456830 17:80421636-80421658 CCACCAATTTGCAGGGTACATCT 0: 1
1: 0
2: 1
3: 8
4: 94
Right 1152456835 17:80421676-80421698 AACCCATCATCTCATAGGTGAGG 0: 1
1: 0
2: 1
3: 18
4: 171
1152456830_1152456838 21 Left 1152456830 17:80421636-80421658 CCACCAATTTGCAGGGTACATCT 0: 1
1: 0
2: 1
3: 8
4: 94
Right 1152456838 17:80421680-80421702 CATCATCTCATAGGTGAGGCAGG 0: 1
1: 0
2: 0
3: 10
4: 147
1152456830_1152456839 22 Left 1152456830 17:80421636-80421658 CCACCAATTTGCAGGGTACATCT 0: 1
1: 0
2: 1
3: 8
4: 94
Right 1152456839 17:80421681-80421703 ATCATCTCATAGGTGAGGCAGGG 0: 1
1: 0
2: 1
3: 7
4: 154
1152456830_1152456841 27 Left 1152456830 17:80421636-80421658 CCACCAATTTGCAGGGTACATCT 0: 1
1: 0
2: 1
3: 8
4: 94
Right 1152456841 17:80421686-80421708 CTCATAGGTGAGGCAGGGAAGGG 0: 1
1: 0
2: 0
3: 24
4: 308

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152456830 Original CRISPR AGATGTACCCTGCAAATTGG TGG (reversed) Intronic
902210062 1:14898588-14898610 AGATGTTCCCTGTAAGCTGGAGG - Intronic
908623973 1:66019288-66019310 AAATGTCCCATGCAAATTGATGG + Intronic
911297143 1:96131914-96131936 AGATGGACCCATTAAATTGGAGG - Intergenic
911855281 1:102868818-102868840 AGCTGTACCCTGCAAAGTCAGGG - Intergenic
912129604 1:106585545-106585567 AGATGTACCCTTAATCTTGGTGG - Intergenic
915004074 1:152620868-152620890 AGATCTAGACTGCTAATTGGTGG + Intergenic
916126186 1:161573594-161573616 AGAACTACCCTTCAAATTGGAGG + Intergenic
916136104 1:161655434-161655456 AGAACTACCCTTCAAATTGGAGG + Intronic
923560455 1:235036315-235036337 AAATGTACACTGCAAATTCTAGG - Intergenic
924323763 1:242875078-242875100 AGGTGTCCCCTGCAATTTGAGGG - Intergenic
1064106120 10:12502327-12502349 TGATGTACCGTGCAAGCTGGAGG + Intronic
1065112303 10:22452273-22452295 AGATTTACCCTTCAACTTGGTGG - Intronic
1068224340 10:54087185-54087207 AATTGTACCCTTTAAATTGGTGG - Intronic
1068730654 10:60354191-60354213 AGATGTGCCATGCATCTTGGGGG - Intronic
1071254502 10:83858213-83858235 ATATGTACTCTGCCATTTGGGGG + Intergenic
1075542608 10:123328205-123328227 AAATGTATCCTGCAAATAAGAGG + Intergenic
1077468434 11:2745209-2745231 AAATTTAACCTGCAAATTCGAGG - Intronic
1078090372 11:8261325-8261347 TGAGGTACACTGCAATTTGGAGG + Intronic
1080372695 11:31670261-31670283 AAATGTACCCTTCAAATTGAGGG + Intronic
1081550373 11:44106207-44106229 AGAAGTACCATGCAAATTCAGGG + Intronic
1085309581 11:75508332-75508354 AGATCTGCCTTGCAAATCGGTGG + Intronic
1087849179 11:103009176-103009198 AGATGCACCCTGCAGAATGCAGG - Intergenic
1091505728 12:1065973-1065995 AGATGTAGAATGCTAATTGGTGG + Intronic
1101889500 12:108700119-108700141 AGATGTACCCTGAATATAAGGGG + Intronic
1109876041 13:68405574-68405596 GGCTGTACCCTGCAAAATGTAGG - Intergenic
1114233257 14:20802578-20802600 AGAAGGAGCCTCCAAATTGGGGG - Intronic
1117427619 14:55617465-55617487 AGATGTGCCATGGAAATTAGAGG + Intronic
1118151300 14:63193914-63193936 AGAAGTACCCTGAAAAAAGGGGG - Intergenic
1118698631 14:68410763-68410785 AGATGTAAGATGCAATTTGGAGG + Intronic
1119216297 14:72871713-72871735 GGCTGTACCCTGCAAAGTGGAGG - Intronic
1123183184 14:106489088-106489110 AGATGTACCTTTCATTTTGGAGG - Intergenic
1137452350 16:48588695-48588717 AGCTGTACTATCCAAATTGGTGG + Intronic
1138041889 16:53680362-53680384 AGATGTGCCCTTTAAATTAGGGG + Intronic
1138928878 16:61627808-61627830 AGCTTTAACCTGCAAATTAGAGG - Intergenic
1140852008 16:78943771-78943793 AGATTTCCCCTTCAAATTGTGGG - Intronic
1146255496 17:31389778-31389800 CGACCTACCCTGCAAAATGGAGG - Intergenic
1147761806 17:42803056-42803078 AGATTTACCCAGCAAACTGGTGG + Intronic
1152306272 17:79522483-79522505 AAATGTACCCTGAAAATAGTTGG - Intergenic
1152456830 17:80421636-80421658 AGATGTACCCTGCAAATTGGTGG - Intronic
1154944028 18:21143159-21143181 AGATGTACCATGTATATTCGTGG - Intergenic
1157961896 18:52163576-52163598 AATTGTACCCTGCAATTTTGGGG + Intergenic
1158921077 18:62191433-62191455 ACATGTACCCTGGAAGTTGAAGG - Intronic
1160784307 19:892560-892582 GGATGGACCCTGGAGATTGGGGG - Intronic
1162102763 19:8349964-8349986 TGGTATTCCCTGCAAATTGGCGG + Intronic
1165005478 19:32802908-32802930 AGGAGAACCCTGAAAATTGGGGG - Intronic
927746238 2:25624062-25624084 AGATGAAGCCTGCAAATAGTAGG - Intronic
932900316 2:75691083-75691105 AGGTGTCCCCTGCAGATTAGGGG - Intronic
935217745 2:100988195-100988217 AGATCTGCCCTGGAAGTTGGGGG - Exonic
935377963 2:102419985-102420007 TGATGTACTCTGCATTTTGGTGG + Intronic
936973084 2:118193267-118193289 AGGGGAACCCTGCAGATTGGAGG + Intergenic
938234872 2:129697775-129697797 AGATGTACACTTCGAATGGGTGG + Intergenic
939887658 2:147698711-147698733 AGATGTACTCTGAAATTTGTAGG - Intergenic
940182608 2:150952687-150952709 AGATGTATCCTGCTGATGGGTGG - Intergenic
943702498 2:191001808-191001830 AGATGTACCCTGCACATACTAGG + Intronic
1171022047 20:21594093-21594115 TGATGTGCCCAGCATATTGGAGG - Intergenic
1174533988 20:51236928-51236950 AGAGTGACCCTGCAAATTGCAGG - Intergenic
1175275030 20:57762541-57762563 ATATGGACCCTGCTATTTGGAGG + Intergenic
1176968520 21:15238927-15238949 AACTGTACCCTGCATTTTGGAGG + Intergenic
1181318268 22:21985225-21985247 AGAGGAACCCTTCAACTTGGAGG + Intergenic
949144226 3:676323-676345 AGATCTACCATGCACATGGGAGG - Intergenic
960462139 3:117949202-117949224 AGATCTACCATGCAAATGGGGGG - Intergenic
961851683 3:129825895-129825917 AGATGTACACTTAAAACTGGTGG + Intronic
963285628 3:143431865-143431887 AGATGTACCTGGCAAATTGGAGG - Intronic
965112786 3:164448849-164448871 AGCTGTACCCTGCAAGCTGCAGG + Intergenic
971181347 4:24330995-24331017 AAATGTACCCAGGAATTTGGAGG - Intergenic
977831468 4:101599054-101599076 GGCTGTCCCCTGCAAACTGGGGG + Intronic
981110080 4:140925265-140925287 AGGTGAAGCCTGCAAACTGGTGG - Intronic
981740384 4:147995695-147995717 AGATGGACCATGCAAATTTTTGG - Intronic
984172059 4:176370867-176370889 AGAACTACCCTGCAAAAAGGGGG + Intergenic
991516264 5:67438979-67439001 AGATGTACCTGGGGAATTGGAGG + Intergenic
996384751 5:122899490-122899512 AGATGGAGCCTGCGAATTCGAGG - Intronic
1001293589 5:170483633-170483655 AGCTGTATCCTGCAAGTTAGTGG + Intronic
1001960247 5:175875912-175875934 AGAGGTACTTTGCAAACTGGTGG + Intronic
1004729968 6:18348020-18348042 AGAAGTACCTTTCAATTTGGTGG - Intergenic
1006968384 6:38013747-38013769 AGGTGTAACCTGGACATTGGAGG - Intronic
1007345637 6:41227846-41227868 AGATGTTCCCTGGAAATGGTGGG - Intergenic
1008248691 6:49210181-49210203 AGATGTAACCTGAATATTGTGGG + Intergenic
1011391111 6:86854726-86854748 AGATGGAGCCTTCAACTTGGGGG - Intergenic
1012485942 6:99722665-99722687 AGATGTACAGTGCAAATTGTTGG - Intergenic
1014685160 6:124488495-124488517 AGATGTACCTGGAAAATGGGTGG - Intronic
1017438123 6:154436943-154436965 ATATGTATCCTTCAAATTAGAGG + Intronic
1024949083 7:54839694-54839716 AGATGCAGCCTGCAGATGGGAGG - Intergenic
1032943529 7:136823568-136823590 ATATGTCCCTTGCAATTTGGGGG - Intergenic
1041854947 8:62440988-62441010 AGATGAAGCCTTCAAAATGGAGG - Intronic
1047536866 8:125727871-125727893 AGATGCACCATGCACATTTGAGG - Intergenic
1050980227 9:12001838-12001860 AGAGACAACCTGCAAATTGGTGG + Intergenic
1051473927 9:17481535-17481557 AGATGTACGCTGCAGTTGGGTGG - Intronic
1054721447 9:68608130-68608152 TGGTGAACCCTGCAATTTGGAGG + Intergenic
1056512623 9:87320275-87320297 AGTTGTATCCTGTAACTTGGAGG + Intergenic
1057871701 9:98722913-98722935 ACATGTATCCGGCACATTGGAGG - Intergenic
1185519467 X:728022-728044 AGCTGGACGCTGCAAATTCGCGG + Intergenic
1185627030 X:1489804-1489826 AGATATTCCCTGCAAATGTGGGG + Intronic
1185627125 X:1490457-1490479 AGATATTCCCTGCAAATGTGGGG + Intronic
1185627145 X:1490588-1490610 AGATATTCCCTGCAAATGTGGGG + Intronic
1185627177 X:1490807-1490829 AGATATTCCCTGCAAATGTGGGG + Intronic
1185627189 X:1490895-1490917 AGATATTCCCTGCAAATGTGGGG + Intronic
1185627214 X:1491075-1491097 AGATATTCCCTGCAAATGTGGGG + Intronic
1186448130 X:9649580-9649602 AGATGTATAATGCAAATTAGAGG + Intronic
1189186911 X:39062632-39062654 AGATGTACCTTGCAAGCTAGTGG + Intergenic
1190106341 X:47563453-47563475 ACATGTACCCTGCAGATAAGGGG - Intronic
1195626794 X:107012179-107012201 AGAAGTAGCTTGCACATTGGTGG + Intergenic
1196849940 X:119927717-119927739 AGATTTCCCCTACAAATAGGAGG - Intronic
1198982870 X:142419159-142419181 AGATGAACCCTCCAAATAGCAGG - Intergenic
1199877577 X:151946586-151946608 AGAGGTAGCCTGCACACTGGAGG - Intergenic