ID: 1152456833

View in Genome Browser
Species Human (GRCh38)
Location 17:80421671-80421693
Sequence TTCCAAACCCATCATCTCAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 188
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 176}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152456823_1152456833 30 Left 1152456823 17:80421618-80421640 CCCGGGGGTACCTGCCCACCACC 0: 1
1: 0
2: 1
3: 17
4: 236
Right 1152456833 17:80421671-80421693 TTCCAAACCCATCATCTCATAGG 0: 1
1: 0
2: 1
3: 10
4: 176
1152456824_1152456833 29 Left 1152456824 17:80421619-80421641 CCGGGGGTACCTGCCCACCACCA 0: 1
1: 0
2: 2
3: 17
4: 230
Right 1152456833 17:80421671-80421693 TTCCAAACCCATCATCTCATAGG 0: 1
1: 0
2: 1
3: 10
4: 176
1152456831_1152456833 9 Left 1152456831 17:80421639-80421661 CCAATTTGCAGGGTACATCTTCT 0: 1
1: 0
2: 0
3: 13
4: 220
Right 1152456833 17:80421671-80421693 TTCCAAACCCATCATCTCATAGG 0: 1
1: 0
2: 1
3: 10
4: 176
1152456830_1152456833 12 Left 1152456830 17:80421636-80421658 CCACCAATTTGCAGGGTACATCT 0: 1
1: 0
2: 1
3: 8
4: 94
Right 1152456833 17:80421671-80421693 TTCCAAACCCATCATCTCATAGG 0: 1
1: 0
2: 1
3: 10
4: 176
1152456829_1152456833 15 Left 1152456829 17:80421633-80421655 CCACCACCAATTTGCAGGGTACA 0: 1
1: 0
2: 1
3: 9
4: 124
Right 1152456833 17:80421671-80421693 TTCCAAACCCATCATCTCATAGG 0: 1
1: 0
2: 1
3: 10
4: 176
1152456825_1152456833 20 Left 1152456825 17:80421628-80421650 CCTGCCCACCACCAATTTGCAGG 0: 1
1: 0
2: 0
3: 16
4: 191
Right 1152456833 17:80421671-80421693 TTCCAAACCCATCATCTCATAGG 0: 1
1: 0
2: 1
3: 10
4: 176
1152456828_1152456833 16 Left 1152456828 17:80421632-80421654 CCCACCACCAATTTGCAGGGTAC 0: 1
1: 0
2: 1
3: 8
4: 90
Right 1152456833 17:80421671-80421693 TTCCAAACCCATCATCTCATAGG 0: 1
1: 0
2: 1
3: 10
4: 176

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152456833 Original CRISPR TTCCAAACCCATCATCTCAT AGG Intronic
901512514 1:9724542-9724564 TTCCAAACCCATCAACAGTTGGG - Intronic
902253419 1:15171315-15171337 TAACAAACCCCTTATCTCATAGG - Exonic
905125168 1:35711060-35711082 TCCCAAACCCATCATCCCCCGGG + Intergenic
907786766 1:57620260-57620282 ATCCAAACTCATCATCTGCTTGG - Intronic
908219924 1:61994875-61994897 TTTATAACCCATCTTCTCATTGG + Intronic
909819663 1:80045932-80045954 TTTCAGGCCCATCATCTTATAGG - Intergenic
911722282 1:101204481-101204503 TTCCAAACCAATTATCTCATAGG + Intergenic
913397752 1:118390894-118390916 TTCAAAATCCACCCTCTCATAGG - Intergenic
919087231 1:192934738-192934760 CTCCAAACCCAACATGTCATGGG + Intergenic
921222560 1:212983577-212983599 TTCCAAACCCATGAACTTTTGGG + Intronic
921320499 1:213934065-213934087 ATCCAAACTCGTCATCCCATCGG + Intergenic
923226200 1:231941021-231941043 TTACAAACACCTCCTCTCATAGG + Intronic
924636896 1:245796956-245796978 TTCCAAATTCATTATTTCATAGG - Intronic
1063400498 10:5739957-5739979 TACCTAACCCATCTTCTGATAGG + Exonic
1063945083 10:11168174-11168196 TTCCCACCCCATGATATCATGGG + Intronic
1067746367 10:48939321-48939343 TTCCAGACCCATGGTCTCACTGG + Intronic
1069841905 10:71345167-71345189 TTCCAAACATATTATGTCATGGG + Intronic
1073671112 10:105590951-105590973 TGCCAAACACTTCATCCCATAGG + Intergenic
1076081645 10:127586934-127586956 TTCCACAAACATCATCTCAGGGG + Intergenic
1076408581 10:130230380-130230402 TTCTATCCCCATCATCTCCTCGG - Intergenic
1078771340 11:14355207-14355229 AACCAAACCCAACATTTCATGGG + Intronic
1081827735 11:46073736-46073758 TTCCAAAACCATGATCTTAATGG + Intronic
1082014526 11:47474851-47474873 TTCCCACTCCATCAACTCATGGG + Intronic
1083245226 11:61421608-61421630 TTGCCAACCCCTCATCTCTTAGG - Exonic
1084890924 11:72236786-72236808 TTCCAAACCTGGCCTCTCATTGG + Intronic
1085135043 11:74079058-74079080 TTTCTAAACCATTATCTCATTGG - Intronic
1085534653 11:77210799-77210821 TTCCATACCCCTCACCTCCTGGG - Intronic
1085730908 11:78997799-78997821 TTCCAATGCCATCACATCATGGG - Intronic
1085835475 11:79951281-79951303 TTCTTAACCCAACATCTCCTGGG - Intergenic
1087384456 11:97452980-97453002 TTTCAAACCCATCTTCTCTCTGG - Intergenic
1088066008 11:105720450-105720472 TGAGAAACCCATCATTTCATAGG - Intronic
1088883607 11:113990265-113990287 TCCCACTCCCATCATCTGATGGG - Exonic
1090351717 11:126112263-126112285 TCCCAAACCCACCTTCTCAAGGG + Intergenic
1090968291 11:131617270-131617292 TCACAAACCCATCATGTCACAGG + Intronic
1091969826 12:4777313-4777335 TTCCAAATCTACCATCTCCTTGG + Intronic
1093696490 12:22166290-22166312 TACCAGATACATCATCTCATGGG + Intronic
1094594889 12:31856251-31856273 TTCCAAGCTTATCATTTCATGGG + Intergenic
1095344721 12:41136549-41136571 TTACAAGCCCTTCATCTCATAGG + Intergenic
1095695912 12:45143920-45143942 TCCAAATCCCATCATCACATTGG + Intergenic
1096876764 12:54635422-54635444 CTTCAAACCCATCCCCTCATGGG - Intergenic
1098518778 12:71410869-71410891 TTGCAAAAACATCATCACATAGG + Intronic
1099776396 12:87137034-87137056 TTCCAAACTAAGCATCTCAAAGG - Intergenic
1101335894 12:103796588-103796610 TTCCATCCCCATCATCCCTTTGG + Intronic
1102163112 12:110785438-110785460 ATCCAAAGCCATCAACCCATTGG - Intergenic
1102447084 12:113011439-113011461 TTCCAGCCCCATCACCTCCTTGG - Exonic
1104949515 12:132432915-132432937 TTCCAAAACCAGCAGCTCAGAGG + Intergenic
1105337963 13:19492252-19492274 ACCCAAACCCACCACCTCATTGG - Intronic
1107267954 13:38579801-38579823 ATCCAAACATATCATATCATGGG + Intergenic
1107997912 13:45879075-45879097 TTCTGTACACATCATCTCATGGG - Intergenic
1108633241 13:52307652-52307674 CCCCAAACCCACCAGCTCATTGG - Intergenic
1108634596 13:52320154-52320176 ACCCAAAGCCATCATCACATTGG - Intergenic
1108653449 13:52504910-52504932 CCCCAAACCCACCAGCTCATTGG + Intergenic
1110132825 13:72028276-72028298 TCCTAAACCCATCAGCTGATTGG + Intergenic
1110481506 13:75982927-75982949 TTCTAAACTCATTTTCTCATTGG - Intergenic
1112616350 13:101010234-101010256 TTCCAAACACATAATTTAATAGG - Intergenic
1116707693 14:48323804-48323826 TTACAAACGAGTCATCTCATAGG - Intergenic
1117725111 14:58665427-58665449 TTCCAAAGCCATTATTTTATAGG - Intergenic
1119563345 14:75608267-75608289 TTTCAAAGCCTTCCTCTCATCGG + Intronic
1121074782 14:91059679-91059701 TTCTAAAGCCATCATCTCCAGGG + Intronic
1124857519 15:33405069-33405091 TTCCATAAACATTATCTCATGGG - Intronic
1125183585 15:36905531-36905553 TGCCAAACCCAGTCTCTCATTGG - Intronic
1126267308 15:46769699-46769721 TTACAAACCAAACAGCTCATGGG + Intergenic
1126375231 15:47990986-47991008 TTCCATACCTTTCATCTCAAAGG - Intergenic
1128989813 15:72250286-72250308 TTCCAGTCCCATCCTCTCTTCGG + Intronic
1129228347 15:74182693-74182715 TTCCACAGACATTATCTCATTGG - Intronic
1135242014 16:20815817-20815839 TTCCAAATCTATTATTTCATTGG - Intronic
1136268330 16:29133568-29133590 TTCCAACTCCAGCCTCTCATGGG + Intergenic
1138656116 16:58492416-58492438 TCCCACACCCTTCATCTCCTGGG + Intronic
1140507356 16:75482189-75482211 TTCCAATCCCAGTATCTCACAGG + Intronic
1140955590 16:79862000-79862022 TTGCAAAGGCAGCATCTCATAGG - Intergenic
1142071639 16:88093902-88093924 TTCCAACTCCAGCCTCTCATGGG + Intronic
1143064608 17:4236129-4236151 TTTCAAATACATCTTCTCATGGG + Intronic
1143289979 17:5821085-5821107 CTCCAACCCCATCATTCCATAGG - Intronic
1146470753 17:33122348-33122370 CTTCAAATCCATCATGTCATGGG - Intronic
1146495767 17:33320596-33320618 TTGCGAACACATCATCTCGTCGG + Intronic
1146528095 17:33584201-33584223 TTTCACATCCATCATCTCAAAGG + Intronic
1147670504 17:42174306-42174328 TTTCACACTCATCATCACATGGG - Intronic
1148284611 17:46376454-46376476 TTCCAAACCCTTCATCATTTAGG + Intergenic
1148306832 17:46594375-46594397 TTCCAAACCCTTCATCATTTAGG + Intronic
1151257181 17:72886943-72886965 CTCAAAACCCATCATCTTACAGG + Intronic
1152456833 17:80421671-80421693 TTCCAAACCCATCATCTCATAGG + Intronic
1153585474 18:6615997-6616019 TTCCTAATCCATTGTCTCATAGG - Intergenic
1154451811 18:14484128-14484150 TTCCAAACACATAAAATCATAGG - Intergenic
1156769479 18:40701671-40701693 TTCCACAGCCATCCTCTGATAGG + Intergenic
1157402627 18:47400843-47400865 TTCCACAACCATCCTCCCATTGG + Intergenic
1157402753 18:47401343-47401365 TTCCACAACCATCCTCCCATTGG + Intergenic
1158127341 18:54115699-54115721 TTCCACACCCTATATCTCATGGG - Intergenic
1159181285 18:64909019-64909041 TTTCAAACCCAGCATGTCTTGGG + Intergenic
1159248848 18:65847372-65847394 TTCAAAACTAATCATCCCATTGG - Intronic
1161014431 19:1976659-1976681 TTCCAAACCCATTGTCTCCACGG + Intronic
1162557126 19:11394204-11394226 TTCCAAAGACATCAGCCCATGGG - Intronic
1163383160 19:16981901-16981923 TGACACACACATCATCTCATTGG - Intronic
1164062731 19:21689676-21689698 TTCCTAACCCAACATACCATGGG + Intergenic
925477728 2:4236945-4236967 TCCCAAATCCATCCTCCCATTGG + Intergenic
929199500 2:39220202-39220224 TTCCAAACTTCTCTTCTCATAGG + Intronic
931419098 2:62109601-62109623 TTCCAATTCTATCACCTCATGGG - Intronic
931449032 2:62352121-62352143 TTCAAATCCAATCATCTCTTTGG - Intergenic
931653224 2:64487545-64487567 CTCCAATCCCACCATCCCATCGG - Intergenic
931809028 2:65836206-65836228 CTCCACACCCATCATCTGATAGG - Intergenic
936828718 2:116613242-116613264 TTTCAAACCTATAATATCATAGG + Intergenic
938367972 2:130749967-130749989 GTCCATACGCATCATCTCACTGG - Intergenic
940522845 2:154773247-154773269 TTCCCTACACATCATATCATAGG + Intronic
941835167 2:170008516-170008538 TTTTAATACCATCATCTCATTGG + Intronic
942571773 2:177322594-177322616 TTCCAGACCCATCCTCCCAAGGG - Intronic
943828819 2:192431615-192431637 TTACTAATCCATCATTTCATGGG + Intergenic
944541281 2:200756191-200756213 CTGCAAACACATCATCTCCTTGG + Intergenic
948881269 2:240858498-240858520 TTCCAAACCCATACTGTCATTGG + Intergenic
1170712432 20:18803857-18803879 GTCCAAACCCATAAACTCTTGGG + Intergenic
1172374676 20:34428140-34428162 TTTCAAACCTGTCATCTCAAAGG - Intronic
1172407525 20:34700766-34700788 ATCCAAACCCCTCATTTTATAGG - Intronic
1173580004 20:44140441-44140463 TGCCAAAACCATCATCCCATAGG - Intronic
1174013349 20:47468518-47468540 TTACAAACACATAATCTCAAGGG + Intergenic
1174443405 20:50574277-50574299 TTCCAAACCCATCGGCTCCCCGG - Intronic
1174954161 20:55077877-55077899 TTCTCATCACATCATCTCATGGG + Intergenic
1175058734 20:56221849-56221871 TTTCAAACTCCTCATCTCAGGGG + Intergenic
1175456160 20:59116032-59116054 GTAGAAACGCATCATCTCATAGG - Intergenic
1176735664 21:10543958-10543980 GCCCAAACCCACCACCTCATTGG + Intronic
1177245717 21:18520404-18520426 TTTCAAAACCTTTATCTCATAGG - Intergenic
1179592394 21:42417644-42417666 TTCTAAACCCATCGATTCATGGG - Intronic
1181010328 22:20036570-20036592 TCCCAAACCCATGCACTCATTGG - Intronic
1181903813 22:26177254-26177276 TTCCACATCTATTATCTCATTGG - Intronic
1183533543 22:38379782-38379804 ACCCAAACCCATCACCTCACTGG - Intronic
1183601007 22:38840666-38840688 CTCCAGACCCATCAACACATCGG - Intronic
1183845022 22:40535941-40535963 TTCCACACCCACTATCTCACTGG + Intronic
950460367 3:13118132-13118154 TAGCACAGCCATCATCTCATCGG - Intergenic
951840184 3:27025887-27025909 TTCCAAAGCCAGCTTCTCAGTGG - Intergenic
955925349 3:63998912-63998934 ACCCAACCCCATCATCTCCTAGG - Intronic
956375989 3:68614140-68614162 TTCTCATCCCATCATTTCATGGG - Intergenic
956951115 3:74283829-74283851 TTCCAAACCCATGTGCTCTTTGG + Intronic
957033036 3:75265215-75265237 ATCCAAACCAATCCTCTCCTTGG - Intergenic
960209863 3:114950029-114950051 AACCAAAGCCATCATATCATGGG + Intronic
960947718 3:122978271-122978293 TTCCTGAGCCATGATCTCATCGG - Intronic
961925536 3:130475824-130475846 TTTCATACCCATTATCTCATTGG + Intronic
966143425 3:176783347-176783369 TTTTAACCCCATCATCTCACAGG + Intergenic
967494578 3:190128622-190128644 CTCCAAACTCATCATCTGGTAGG + Intergenic
971896344 4:32601272-32601294 TTCCAAAATAATCATATCATTGG - Intergenic
973846548 4:54918610-54918632 TTCTAAACCTATCATTTCTTTGG - Intergenic
976582164 4:86749825-86749847 TGCCAAACCCACCTTCTCACTGG - Intronic
979069514 4:116184232-116184254 TTTCATATGCATCATCTCATTGG - Intergenic
982313587 4:154009764-154009786 TTCCGAACCCATTAACTAATGGG + Intergenic
982933996 4:161447956-161447978 TTCAGAACCTATTATCTCATGGG - Intronic
983142633 4:164171735-164171757 ATCCAAATGCCTCATCTCATTGG + Intronic
984765340 4:183396432-183396454 TTTGAAACCCATCTTCTCATAGG - Intergenic
986103051 5:4631630-4631652 TGCCAAACCCAGCAGCTCAGGGG - Intergenic
993100652 5:83535712-83535734 TTCCCAACCTATCATCTAAAGGG - Intronic
993521605 5:88909311-88909333 TTCAACAGCTATCATCTCATGGG + Intergenic
997534112 5:134603370-134603392 TTCAAAACCCAGCATTTCACAGG - Exonic
999823490 5:155251869-155251891 CTCCAAACGCCTCATCTCCTTGG + Intergenic
1001824485 5:174734428-174734450 CTCCAAACCCAACTTTTCATGGG + Intergenic
1004103463 6:12640133-12640155 TTCAAACCCCATCAACACATGGG + Intergenic
1005313729 6:24584661-24584683 ATCCAAACCTATCATGTTATAGG + Intronic
1006412831 6:33885243-33885265 TTCCATACCCATTAACTCATGGG + Intergenic
1008427679 6:51378535-51378557 TTCCAAATACATCATATCAAGGG - Intergenic
1008593301 6:53015365-53015387 TTCCCAATCCATCCTCCCATGGG - Intronic
1011885192 6:92084870-92084892 TTCCAAACACATCTTCCCATAGG - Intergenic
1012375540 6:98557587-98557609 TTCTAAACCTTTCATTTCATAGG - Intergenic
1012509648 6:99988510-99988532 TGCCAAACCAATCATTGCATTGG + Intronic
1015733543 6:136372959-136372981 TTCCAGAACCATCAGCTAATAGG - Intronic
1015824113 6:137293810-137293832 TTTCAAACACATCATCTTGTTGG + Intergenic
1016757689 6:147704627-147704649 TTCCAAGGCCATCATCACACAGG - Intronic
1017292135 6:152750765-152750787 TTCAAAGCCCATCATTTTATAGG - Intergenic
1020963756 7:14839848-14839870 TTCCAAATCTATAATTTCATAGG - Intronic
1022170903 7:27829307-27829329 TTAAAAACCTATCATTTCATGGG - Intronic
1023026431 7:36054796-36054818 TTCTAATCCCATCATTTCCTGGG - Intergenic
1023250488 7:38255123-38255145 TTACAAAACCATCAACTCCTGGG - Intergenic
1023251792 7:38271222-38271244 TTACAAAACCATCAACTCCTGGG - Intergenic
1026094296 7:67330371-67330393 TTCCACAGCTATCATCTCATGGG - Intergenic
1027518931 7:79180010-79180032 TTCCAAACTATTCATCTAATAGG + Intronic
1032141466 7:129335024-129335046 TTCCAAACCACTAATTTCATAGG - Intronic
1032534320 7:132649029-132649051 TTACATACCCCTCATCGCATTGG - Exonic
1035675632 8:1453737-1453759 TTCCAAACACATTTTCTAATAGG - Intergenic
1038468477 8:27789312-27789334 GTCCAAACACATCCTATCATTGG + Intronic
1039223781 8:35365191-35365213 TTCCATTCCCATTATCTCCTAGG + Intronic
1040637678 8:49294268-49294290 GTCAAAACCCTTCATTTCATAGG - Intergenic
1043323448 8:79019514-79019536 TTCCAAATGTGTCATCTCATAGG - Intergenic
1045708587 8:104957171-104957193 TTCCAACCCCTTTATCTTATAGG - Intronic
1048006591 8:130424545-130424567 TTCCAATCCCAGCATGTCACTGG - Intronic
1051524089 9:18023041-18023063 TTCCAAACCATTCATTCCATTGG - Intergenic
1053195980 9:36118945-36118967 ATGCAAACCCATCATCCCACCGG + Exonic
1186134803 X:6507786-6507808 TGCAAAACCCATCATCACAGTGG + Intergenic
1188491909 X:30746892-30746914 TTCAAGAACCATCATCTCTTAGG + Intergenic
1189496716 X:41515254-41515276 TTCCAATCCCTTCAGCTCCTGGG + Intronic
1193946518 X:87742634-87742656 TTTCTAACCCATCCTTTCATGGG + Intergenic
1194837852 X:98703276-98703298 TTCCAAACTCTTCATCTGACAGG - Intergenic
1197453495 X:126647538-126647560 TTCCAAACCTGTATTCTCATGGG - Intergenic
1201585808 Y:15559981-15560003 TTTCAAATACATTATCTCATAGG - Intergenic
1202016184 Y:20409112-20409134 TTCTAATTCCATAATCTCATGGG + Intergenic
1202593906 Y:26516281-26516303 ACCCAAACCCACCACCTCATTGG + Intergenic