ID: 1152456835

View in Genome Browser
Species Human (GRCh38)
Location 17:80421676-80421698
Sequence AACCCATCATCTCATAGGTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 191
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 171}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152456830_1152456835 17 Left 1152456830 17:80421636-80421658 CCACCAATTTGCAGGGTACATCT 0: 1
1: 0
2: 1
3: 8
4: 94
Right 1152456835 17:80421676-80421698 AACCCATCATCTCATAGGTGAGG 0: 1
1: 0
2: 1
3: 18
4: 171
1152456825_1152456835 25 Left 1152456825 17:80421628-80421650 CCTGCCCACCACCAATTTGCAGG 0: 1
1: 0
2: 0
3: 16
4: 191
Right 1152456835 17:80421676-80421698 AACCCATCATCTCATAGGTGAGG 0: 1
1: 0
2: 1
3: 18
4: 171
1152456831_1152456835 14 Left 1152456831 17:80421639-80421661 CCAATTTGCAGGGTACATCTTCT 0: 1
1: 0
2: 0
3: 13
4: 220
Right 1152456835 17:80421676-80421698 AACCCATCATCTCATAGGTGAGG 0: 1
1: 0
2: 1
3: 18
4: 171
1152456828_1152456835 21 Left 1152456828 17:80421632-80421654 CCCACCACCAATTTGCAGGGTAC 0: 1
1: 0
2: 1
3: 8
4: 90
Right 1152456835 17:80421676-80421698 AACCCATCATCTCATAGGTGAGG 0: 1
1: 0
2: 1
3: 18
4: 171
1152456829_1152456835 20 Left 1152456829 17:80421633-80421655 CCACCACCAATTTGCAGGGTACA 0: 1
1: 0
2: 1
3: 9
4: 124
Right 1152456835 17:80421676-80421698 AACCCATCATCTCATAGGTGAGG 0: 1
1: 0
2: 1
3: 18
4: 171

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152456835 Original CRISPR AACCCATCATCTCATAGGTG AGG Intronic
902843926 1:19094604-19094626 AACCTTTCATTTCATAGTTGAGG - Intronic
904957466 1:34296964-34296986 AACGCATCAACTGATAGGTTTGG + Intergenic
904974043 1:34442413-34442435 ACCCCATGATCTCCTAGGTGAGG + Intergenic
904978169 1:34474357-34474379 AACCCACCATTCCATAGGTTAGG - Intergenic
905219282 1:36433152-36433174 AAGCCATCTCCACATAGGTGTGG + Intronic
910287593 1:85572755-85572777 ATCCTATCATCTCATAGATGAGG + Intronic
910645338 1:89508398-89508420 TACCCAAAATCTCAGAGGTGAGG + Intergenic
911230515 1:95356412-95356434 TACCCATCATGTCAGAGGAGGGG + Intergenic
911520257 1:98921337-98921359 AATGCCTCATCTCACAGGTGAGG + Intronic
912197868 1:107421232-107421254 TACCCATCAGCTTATTGGTGAGG + Intronic
913175931 1:116273308-116273330 AACCCTTCATCTCATGGAGGTGG - Intergenic
913317745 1:117566762-117566784 AACCCATCATTGAATACGTGAGG - Intergenic
914423396 1:147551178-147551200 ATACCTTCATCTCATAGTTGAGG + Intronic
915058901 1:153163289-153163311 GACAAATTATCTCATAGGTGAGG + Intergenic
915790585 1:158665825-158665847 AACCCCTTATTTTATAGGTGAGG + Intronic
915992666 1:160532362-160532384 CACCCATCATCTGGGAGGTGAGG + Intergenic
916184240 1:162115341-162115363 TACCCATCATCACATAGCTAGGG - Intronic
916429727 1:164715898-164715920 AAGCCATCATCTCATAGTGTAGG - Intronic
917328525 1:173858432-173858454 ATACCATCATCTCATATTTGTGG - Exonic
917416171 1:174812188-174812210 AAACATTTATCTCATAGGTGGGG + Intronic
917505029 1:175619644-175619666 AACCCACCGTCTTATAGATGAGG + Intronic
918132818 1:181644355-181644377 AACTCATCATTCCATAGGAGAGG - Intronic
918877519 1:190067917-190067939 AACCCACAATCACATGGGTGGGG + Intergenic
920352902 1:205349465-205349487 TACCCATCATCCCATATCTGGGG - Intronic
921320501 1:213934070-213934092 AACTCGTCATCCCATCGGTGAGG + Intergenic
922546433 1:226460855-226460877 ACCCCATCATCCCATAACTGTGG - Intergenic
1062950079 10:1492539-1492561 AATCCATCCTCTCATAGTTCTGG - Intronic
1067047956 10:42996509-42996531 AACCCATCCTCCCATGGGTGGGG + Intergenic
1070135414 10:73689600-73689622 CACCCATCATCTGAGATGTGGGG + Intronic
1071311523 10:84347876-84347898 CACCCATCATCTGAGATGTGGGG - Intronic
1071527954 10:86368861-86368883 AACCCACCAACACATAGTTGTGG + Intergenic
1075439897 10:122471638-122471660 AACCCTTCACTTCACAGGTGGGG + Intronic
1076121771 10:127941926-127941948 AACCCTTGATCTCATCAGTGTGG + Intronic
1078527678 11:12112448-12112470 AAGCCAGCTTCTCAGAGGTGAGG - Intronic
1083300895 11:61739164-61739186 AACCCCTCATCTAGTAGATGGGG - Intronic
1085723299 11:78932288-78932310 AGCCCATCATCTCATAGGGCTGG - Intronic
1090704075 11:129320805-129320827 ATCCCCTCATTTCATAGTTGAGG - Intergenic
1091857574 12:3752070-3752092 AACCCATCACCTCATGAGTTAGG + Intronic
1092978838 12:13773055-13773077 AACCCATCACCCCATTGGTCTGG - Intronic
1095288945 12:40452876-40452898 ACCTCATCATTTTATAGGTGAGG + Intronic
1095344722 12:41136554-41136576 AGCCCTTCATCTCATAGGTATGG + Intergenic
1098734448 12:74081494-74081516 TATCCATCATCACAAAGGTGTGG - Intergenic
1101056279 12:100918388-100918410 TACCCATCATTTCACAGCTGAGG + Intronic
1110965408 13:81688880-81688902 ATCCCAGCAGCTCAGAGGTGAGG - Intergenic
1111009945 13:82299648-82299670 AACCAATATTCTTATAGGTGGGG + Intergenic
1112107406 13:96256292-96256314 ATTCCATCATCTCAAAAGTGTGG + Intronic
1118227109 14:63912136-63912158 AAGCCTTCATCTTATAGGTATGG - Intronic
1120250707 14:82059387-82059409 ACCCCATGAGCCCATAGGTGCGG + Intergenic
1120309918 14:82814671-82814693 AACCCATCGTCTGAGATGTGGGG - Intergenic
1120732860 14:88022615-88022637 AAACCCTCATTTTATAGGTGAGG + Intergenic
1120892826 14:89505847-89505869 CACCCATCATCTGAGATGTGGGG + Intronic
1121557423 14:94848982-94849004 ACCCTCTCATCTCATTGGTGAGG - Intergenic
1121875399 14:97446693-97446715 AAACCATCATTTTATAGTTGAGG - Intergenic
1126574593 15:50184375-50184397 ACCCCTTCATTTCATAGCTGGGG + Intronic
1128662470 15:69512531-69512553 AACTCATGGTCTCATAGGAGAGG + Intergenic
1128799903 15:70490636-70490658 CTCCCATCAGCTCATAGGTGAGG - Intergenic
1128832921 15:70785894-70785916 ATTCCATCACCTTATAGGTGAGG + Intergenic
1129523852 15:76201905-76201927 CACCCCTCATCTCAGAGATGGGG + Intronic
1131714268 15:95091323-95091345 AACCCATAAACCCATAGCTGAGG - Intergenic
1133833862 16:9350259-9350281 CACCCATCATCTGGGAGGTGAGG - Intergenic
1134213038 16:12294264-12294286 CACCCGTCATCTCTTGGGTGAGG + Intronic
1134995269 16:18734333-18734355 CACCCATCATCTGAGATGTGGGG + Intergenic
1137830262 16:51537553-51537575 ATCCCATCATTTCATAGGTGGGG + Intergenic
1138071910 16:54000978-54001000 AACCCCTCATTTTATAGCTGGGG - Intronic
1138742044 16:59322302-59322324 ATACCTTCATCTTATAGGTGAGG + Intergenic
1141809772 16:86368116-86368138 AACCCTTCATCTCAGAGTGGAGG + Intergenic
1143117455 17:4588919-4588941 AACCCATCATCACACAGATGGGG - Intronic
1143764741 17:9130154-9130176 CAGCAGTCATCTCATAGGTGTGG + Intronic
1147395835 17:40142015-40142037 CATCCATCATTTTATAGGTGGGG + Intronic
1148679803 17:49466998-49467020 AACTCATTATTTTATAGGTGGGG + Intronic
1149996233 17:61407348-61407370 AAGCCATTATCTCAAAGGTCAGG + Intronic
1150226098 17:63525251-63525273 ATCCCTTCATTTCATAGATGTGG + Intronic
1150632763 17:66891704-66891726 ATCCCACCATCTCAGATGTGAGG + Intergenic
1150967850 17:69991963-69991985 AACCCATCATCTGAGACATGGGG - Intergenic
1151222395 17:72622791-72622813 CACCCATCATCTCAAAGCTACGG + Intergenic
1152456835 17:80421676-80421698 AACCCATCATCTCATAGGTGAGG + Intronic
1153516184 18:5903851-5903873 ATCTCTTCACCTCATAGGTGAGG + Intergenic
1154115981 18:11613610-11613632 CACCCATCATCTGGTAGGTGAGG + Intergenic
1154116043 18:11613847-11613869 CACCCATCGTCTGGTAGGTGAGG + Intergenic
1154120372 18:11647600-11647622 CGCCCATCATCTGGTAGGTGAGG + Intergenic
1154120407 18:11647719-11647741 CGCCCATCATCTGGTAGGTGAGG + Intergenic
1154483285 18:14856670-14856692 TGCCCATCATCTGGTAGGTGAGG - Intergenic
1154483704 18:14858290-14858312 TGCCCATCATCTGGTAGGTGAGG - Intergenic
1154484125 18:14859910-14859932 TGCCCATCATCTGGTAGGTGAGG - Intergenic
1155404892 18:25476852-25476874 AATCCATCATTTTATAGATGGGG + Intergenic
1155580676 18:27302158-27302180 AACCGCTCATCTCATTGATGAGG + Intergenic
1161682207 19:5685921-5685943 AACCCACCTTCTCATGGGTTAGG + Intronic
1165947706 19:39454746-39454768 AACCCCTCTTCCCATAGGTAAGG - Intronic
926251155 2:11156091-11156113 AACCCCTTATTTCACAGGTGAGG - Intronic
927077934 2:19598725-19598747 AACCCATCATCTCTAAGGCAGGG + Intergenic
928758116 2:34549828-34549850 AACCCATCATGTCTTAGTGGTGG + Intergenic
932367208 2:71161026-71161048 CACCCATCATCTGAGATGTGGGG + Intergenic
937220212 2:120338791-120338813 AACCCATAATCTAATATATGGGG + Intergenic
937426898 2:121807425-121807447 AACGCATAATATCCTAGGTGTGG + Intergenic
939646824 2:144710271-144710293 TACACAACATCTTATAGGTGAGG - Intergenic
943144608 2:184026186-184026208 AAACCATCATCTCTCAGATGTGG + Intergenic
945074103 2:206020467-206020489 AACTCTTCATCTCATACATGGGG + Intronic
945814449 2:214587168-214587190 AACCCTTTATTTCCTAGGTGAGG + Intergenic
946430583 2:219625183-219625205 ACTCCATCATCTCAGAGGGGTGG + Intergenic
947143614 2:227042902-227042924 AACCCACTAGCTTATAGGTGAGG + Intronic
1170526272 20:17240990-17241012 AACCCTTCATTTTATACGTGAGG - Intronic
1172407523 20:34700761-34700783 AACCCCTCATTTTATAGGTGAGG - Intronic
1173592500 20:44235851-44235873 AACTCATTTTCTCATAGTTGTGG + Intergenic
1174339179 20:49885279-49885301 ACACCAGCATCTCATAGGTATGG + Intronic
1178043432 21:28667753-28667775 AATCCATCTTCTCATTGGTATGG + Intergenic
1179195172 21:39157241-39157263 AGCCCATCATCTGAGATGTGGGG + Intergenic
1182331088 22:29552357-29552379 CGCCCATCATCTCAGATGTGGGG + Intronic
1182906385 22:33940928-33940950 ATCCCATGATGTCATAGATGTGG - Intergenic
951290527 3:20867175-20867197 CACCCATCATCTGAGATGTGGGG - Intergenic
953029470 3:39168892-39168914 AACCCTTCATTTCAATGGTGAGG - Intergenic
956760053 3:72434208-72434230 AATCCATCATCTCAGAGTTAAGG + Intronic
957498995 3:81028752-81028774 AATCCATTGTCTCATAGTTGTGG + Intergenic
958406133 3:93760867-93760889 CACCCATCATCTGGGAGGTGAGG - Intergenic
958406144 3:93760906-93760928 CACCCATCATCTGGGAGGTGAGG - Intergenic
958406211 3:93761132-93761154 CACCCATCATCTGGGAGGTGAGG - Intergenic
959874100 3:111361433-111361455 AACCCATCATCTCATAAATAGGG - Intronic
960230976 3:115227055-115227077 AATCCATCATCTGACAGCTGTGG + Intergenic
960471087 3:118065888-118065910 AACCCTACATCTCATAAGGGGGG + Intergenic
962265978 3:133944627-133944649 AACCCCTCAGCTCCCAGGTGTGG - Intronic
962879495 3:139562781-139562803 AGCTCATCATCTCATGGATGGGG - Intronic
964448430 3:156785362-156785384 ATCCCCTCATCTTATAGATGAGG + Intergenic
965085723 3:164094736-164094758 ATCCCCTCATTTTATAGGTGAGG + Intergenic
965336871 3:167437281-167437303 AATCCTTCATTTTATAGGTGAGG + Intergenic
967289329 3:187903786-187903808 ATCCCATCATTGCATAGATGGGG - Intergenic
968003654 3:195224811-195224833 AGCCCCTCATTTCACAGGTGGGG + Intronic
972700672 4:41491257-41491279 CACCCATCATCTAGGAGGTGAGG - Intronic
977226611 4:94399407-94399429 AACCCAACATTTCAGAGATGGGG + Intergenic
982820975 4:159940038-159940060 CACCCATCATCTGAGATGTGGGG - Intergenic
983547193 4:168976659-168976681 AAAGCATCTTCTCAAAGGTGTGG + Intronic
983869191 4:172805100-172805122 CACCCTTCATCTTATAGCTGAGG + Intronic
989048408 5:37295659-37295681 CACCCATCATCTGAGATGTGGGG + Intronic
989828831 5:45890548-45890570 CACCCATCATCTGAGATGTGGGG + Intergenic
990373658 5:55147864-55147886 AACCCTTCATTTCACAGATGGGG + Intronic
991630852 5:68655252-68655274 AAACGATCATCTCATAGCTATGG - Intergenic
992564435 5:77984284-77984306 GACCCCTCATCTCTTGGGTGAGG + Intergenic
993477039 5:88379003-88379025 AACCTATCATCTTATAGTTCTGG + Intergenic
993647431 5:90477523-90477545 AACCCCTCATCTAATAGTAGAGG - Intronic
998000535 5:138621614-138621636 AACTAATCGTCTCATAGGAGAGG + Intronic
998797274 5:145833882-145833904 ACCCCTTCATCTTATAGATGTGG + Intronic
999330999 5:150673211-150673233 AACCCCTCATTTTACAGGTGGGG - Intronic
999365260 5:151019650-151019672 ATCCCATCATTACATAGCTGAGG + Intergenic
999577126 5:152991530-152991552 TAGCCATCATCTCACATGTGTGG + Intergenic
999604221 5:153297165-153297187 CACCCATCATCTGAGATGTGGGG - Intergenic
999819917 5:155216446-155216468 TGCCCATCATCTCCTAGGGGTGG + Intergenic
1000025830 5:157358428-157358450 AACCCCTCATTTCATAGATGTGG + Intronic
1002293211 5:178213652-178213674 GACCCCTCATCTCAGAGATGAGG - Intronic
1004796074 6:19086529-19086551 AACCCATAATCTCCTATTTGAGG - Intergenic
1004816483 6:19316676-19316698 AACCAATCATGGCAAAGGTGGGG - Intergenic
1005313733 6:24584666-24584688 AACCTATCATGTTATAGGTGGGG + Intronic
1006346350 6:33485946-33485968 CACCCATCATCTGAGATGTGGGG - Intergenic
1007229772 6:40340116-40340138 ACCCCAGCATCACAGAGGTGGGG + Intergenic
1007510683 6:42372333-42372355 AACCCATCAGCTCCTACATGAGG + Intronic
1010407438 6:75521069-75521091 CACCCATCATCTAATTGGTGAGG + Intergenic
1011363132 6:86549720-86549742 AACCCATCTTCTCATCAGTGAGG + Intergenic
1016253550 6:142076182-142076204 AATCCATCATCACTTTGGTGAGG - Intronic
1016802258 6:148179207-148179229 CACCCATCATCTGAGATGTGGGG - Intergenic
1020157242 7:5736692-5736714 CACCCATCATCTGAGACGTGGGG + Intronic
1022339150 7:29452269-29452291 AGACCATCATCTCCTGGGTGAGG + Intronic
1028817166 7:95159517-95159539 AACCCATCATTTAATTAGTGTGG + Intronic
1032589342 7:133177549-133177571 AGCCCATCATCTGAGATGTGGGG + Intergenic
1032664361 7:134020698-134020720 AACCCTTCATTTTATAGATGAGG - Intronic
1032993388 7:137418966-137418988 AACCTTTCATTTCATAGATGAGG + Intronic
1035398775 7:158551565-158551587 AACCCATCACATCAGGGGTGGGG + Intronic
1035398836 7:158551791-158551813 AACCCATCACATCAGGGGTGGGG + Intronic
1035398898 7:158552017-158552039 AACCCATCACATCAGGGGTGGGG + Intronic
1038119194 8:24592800-24592822 AACCTATCATTTGATAGATGTGG - Intergenic
1038195506 8:25363236-25363258 AACCCATCATCTGTAAAGTGAGG + Intronic
1040866360 8:52052380-52052402 ATCCCATGTTCTCATAAGTGGGG - Intergenic
1041513626 8:58676632-58676654 CACCCATCATCTGAGATGTGGGG - Intergenic
1042535604 8:69855640-69855662 CACCCATCATCTGGGAGGTGAGG + Intergenic
1042881167 8:73491734-73491756 AACCCATTATTTCACAGATGAGG + Intronic
1046785687 8:118263925-118263947 AAACCATCATCTCATGGCTAAGG - Intronic
1047952990 8:129950950-129950972 AACCCTTCATTTCTGAGGTGAGG - Intronic
1048138469 8:131769747-131769769 ACCCCCTCATCTAATATGTGAGG - Intergenic
1048260156 8:132938409-132938431 AACCCCTCATCTCACAGATGAGG + Intronic
1050241804 9:3644350-3644372 AAGCCACTATTTCATAGGTGGGG - Intergenic
1050285662 9:4099243-4099265 AATGTATCATCTCATAGGTCTGG + Intronic
1052254959 9:26445171-26445193 AACCCCACATGTCATGGGTGGGG - Intergenic
1056721514 9:89076070-89076092 CACCCAGAATCTCATGGGTGGGG - Intronic
1057765347 9:97912105-97912127 CAATCCTCATCTCATAGGTGAGG - Intronic
1058368164 9:104234838-104234860 CACCCATCATCTGGGAGGTGAGG - Intergenic
1059290559 9:113220642-113220664 GACTCATAATCTAATAGGTGCGG + Intronic
1060317548 9:122526702-122526724 AAACCATCATCTCGTTGATGTGG + Exonic
1186430942 X:9503692-9503714 AACCCATCCTTTCTTAGTTGGGG + Intronic
1186451586 X:9678368-9678390 AACACATCAACTCATGGGTGTGG + Intronic
1187562729 X:20418132-20418154 AATCCATCATTTCCTAGGAGGGG + Intergenic
1192274983 X:69619364-69619386 AGCCCATCATCTCATAAGTATGG - Intronic
1192450256 X:71240347-71240369 AACCAATTATTTCATAGGAGGGG + Exonic
1199452754 X:147992800-147992822 CACCCATCATCTGAGATGTGGGG - Intronic
1200760857 Y:7037641-7037663 AAACCATCAACTCATGGGTGTGG + Intronic
1202029017 Y:20552611-20552633 CACCCATCATCTGGGAGGTGAGG + Intergenic