ID: 1152456838

View in Genome Browser
Species Human (GRCh38)
Location 17:80421680-80421702
Sequence CATCATCTCATAGGTGAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 158
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 147}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152456825_1152456838 29 Left 1152456825 17:80421628-80421650 CCTGCCCACCACCAATTTGCAGG 0: 1
1: 0
2: 0
3: 16
4: 191
Right 1152456838 17:80421680-80421702 CATCATCTCATAGGTGAGGCAGG 0: 1
1: 0
2: 0
3: 10
4: 147
1152456828_1152456838 25 Left 1152456828 17:80421632-80421654 CCCACCACCAATTTGCAGGGTAC 0: 1
1: 0
2: 1
3: 8
4: 90
Right 1152456838 17:80421680-80421702 CATCATCTCATAGGTGAGGCAGG 0: 1
1: 0
2: 0
3: 10
4: 147
1152456832_1152456838 -9 Left 1152456832 17:80421666-80421688 CCTTCTTCCAAACCCATCATCTC 0: 1
1: 0
2: 4
3: 31
4: 417
Right 1152456838 17:80421680-80421702 CATCATCTCATAGGTGAGGCAGG 0: 1
1: 0
2: 0
3: 10
4: 147
1152456830_1152456838 21 Left 1152456830 17:80421636-80421658 CCACCAATTTGCAGGGTACATCT 0: 1
1: 0
2: 1
3: 8
4: 94
Right 1152456838 17:80421680-80421702 CATCATCTCATAGGTGAGGCAGG 0: 1
1: 0
2: 0
3: 10
4: 147
1152456829_1152456838 24 Left 1152456829 17:80421633-80421655 CCACCACCAATTTGCAGGGTACA 0: 1
1: 0
2: 1
3: 9
4: 124
Right 1152456838 17:80421680-80421702 CATCATCTCATAGGTGAGGCAGG 0: 1
1: 0
2: 0
3: 10
4: 147
1152456831_1152456838 18 Left 1152456831 17:80421639-80421661 CCAATTTGCAGGGTACATCTTCT 0: 1
1: 0
2: 0
3: 13
4: 220
Right 1152456838 17:80421680-80421702 CATCATCTCATAGGTGAGGCAGG 0: 1
1: 0
2: 0
3: 10
4: 147

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152456838 Original CRISPR CATCATCTCATAGGTGAGGC AGG Intronic
903653036 1:24932590-24932612 CATCTTATCAGAGGTGAGGAAGG - Intronic
903855610 1:26336328-26336350 CTTCGTCTCAAAGGTAAGGCAGG - Exonic
906729422 1:48068572-48068594 CATGATTTCATGAGTGAGGCAGG + Intergenic
907395568 1:54187387-54187409 CATCACCTCTTAGGGGAGGTGGG - Intronic
909147788 1:71959166-71959188 CATCATGTCATAAGTGATGATGG - Intronic
915706262 1:157846701-157846723 CATCATCTCCTTGGTAAGGAAGG - Intronic
920916476 1:210261951-210261973 CTTCATCTGATAGGGGAGACTGG - Intergenic
921149357 1:212387182-212387204 CTTCACCTCCTTGGTGAGGCAGG - Intronic
921553860 1:216572610-216572632 CACCATGTCATAAATGAGGCAGG + Intronic
923886577 1:238164354-238164376 CATCAGCTCATGGGTGTGGGGGG + Intergenic
924932682 1:248744809-248744831 CATCATTCTATAGGTGAGGGTGG - Intronic
1062919940 10:1272169-1272191 CATCATCTCATCCAGGAGGCAGG + Intronic
1063998852 10:11646009-11646031 TATCATTTAATAGATGAGGCTGG + Intergenic
1064738011 10:18402916-18402938 ACTCATCTCAGAGATGAGGCAGG - Intronic
1064965438 10:21011486-21011508 CATCATCTCAGAGGGGAACCAGG - Intronic
1067478345 10:46580257-46580279 CAGCTCCTCATAGGTGAGGGTGG - Exonic
1067616393 10:47761530-47761552 CAGCTCCTCATAGGTGAGGGTGG + Intergenic
1067914880 10:50386759-50386781 CTCCATCTCACAGGTGGGGCAGG - Intronic
1069555479 10:69394940-69394962 CATCTTCTCATACCTGAGACAGG - Exonic
1071517550 10:86308762-86308784 CATCATCTCATAGCAGAAGGCGG + Intronic
1072670878 10:97427994-97428016 CCTCATCTTTTAGGAGAGGCTGG + Intronic
1075468796 10:122672463-122672485 CAACACCCCAGAGGTGAGGCAGG - Intergenic
1075705057 10:124495502-124495524 GTTCATCTCACAGGTGTGGCTGG + Intronic
1076069885 10:127480387-127480409 CATTATCTCACACGTGAGCCTGG - Intergenic
1076630208 10:131847731-131847753 CTTCATCTCACAGGCGAGGCTGG + Intergenic
1076662895 10:132067318-132067340 CCTCAACTCACAGGAGAGGCAGG - Intergenic
1079839398 11:25376837-25376859 CATCATTTCAGTGGTGAGTCAGG - Intergenic
1082765955 11:57167858-57167880 CACCATCTCATAGGTGAAAGTGG + Intergenic
1082916715 11:58445788-58445810 CATCATGGCAGAGGGGAGGCAGG + Intergenic
1084667013 11:70582001-70582023 CAGCAGCTCCTAGGGGAGGCAGG - Intronic
1085318241 11:75558964-75558986 CAGCATATCAGAGGTGGGGCTGG - Intergenic
1089237546 11:117044769-117044791 CAGCTACTCACAGGTGAGGCAGG + Intronic
1092496683 12:9003053-9003075 CAACTTCTCATTGGTGAGGCTGG - Intronic
1098580702 12:72095484-72095506 CCTCATCTCTAAGGTGAGGAGGG - Intronic
1100241925 12:92718314-92718336 CATCAGCTCATCTGTTAGGCTGG + Intergenic
1101018435 12:100526833-100526855 CATCATCTCAAAGGTGTTGGAGG - Intronic
1101434700 12:104654710-104654732 CCCCAGCTCATAGCTGAGGCTGG + Intronic
1102815419 12:115861354-115861376 CATGATTACATGGGTGAGGCAGG + Intergenic
1103555295 12:121762765-121762787 CATCATCTCTCTGGTGGGGCAGG - Intronic
1103910244 12:124348217-124348239 CATCATGTCATAGGTGCGCTTGG + Exonic
1104028305 12:125045621-125045643 CATCATCTTAGAGGCCAGGCGGG - Intergenic
1104471545 12:129033752-129033774 GGTCATCTAAAAGGTGAGGCTGG - Intergenic
1106361021 13:29030529-29030551 CATCATGTCATAGCTGTAGCAGG - Intronic
1107069308 13:36253448-36253470 CAGCTACTCAGAGGTGAGGCAGG - Intronic
1108066623 13:46584338-46584360 CACCAGCTCCTAGGTGATGCCGG - Intronic
1111226981 13:85287705-85287727 CATCTTCACAATGGTGAGGCAGG + Intergenic
1111452065 13:88432394-88432416 CATCATCTCATACTTGACACTGG - Intergenic
1117051545 14:51865328-51865350 CATCATCTTGGAGGTGAGGGTGG - Intronic
1119688325 14:76651011-76651033 AATCATCTCTCAGCTGAGGCTGG - Intergenic
1120952103 14:90051025-90051047 CAGCATCTCATTGGTGGGGTTGG + Intergenic
1121563983 14:94894981-94895003 CCTCAACTCATAGATGAGGAAGG - Intergenic
1202875979 14_KI270722v1_random:782-804 CAGCACCTCAGAGGTGAGGGAGG - Intergenic
1124151195 15:27179928-27179950 CATCGCCTCCTAGATGAGGCTGG + Intronic
1129786795 15:78315010-78315032 CTTCATTTTACAGGTGAGGCTGG - Intergenic
1130530429 15:84743743-84743765 CACCCTCTCTTAGGTCAGGCAGG - Intergenic
1134685397 16:16154863-16154885 CATCATCCCCCAGGTGAGGCTGG - Exonic
1137498796 16:48994625-48994647 CCTCATCTCAGAAGTTAGGCTGG - Intergenic
1138998966 16:62485608-62485630 CATCACCTCATAGATGCAGCTGG + Intergenic
1139550636 16:67670884-67670906 TGTCTTCTCACAGGTGAGGCAGG + Intergenic
1142742701 17:1940446-1940468 CATCATCTCCTACGTGTGGTAGG - Intronic
1143594132 17:7904116-7904138 CTTCGTCTAATAGGTGAGACTGG + Intronic
1146655333 17:34631637-34631659 CATCATCTCAGAGGGGTGGGTGG - Intronic
1148013904 17:44507218-44507240 CATAAGCCCATGGGTGAGGCAGG - Intergenic
1149423738 17:56534905-56534927 CATCATCTCAAAGTTGTGGGTGG + Intergenic
1149574025 17:57698413-57698435 CAGCCTCACATAGCTGAGGCAGG - Intergenic
1151266786 17:72962730-72962752 TTTCATCACATTGGTGAGGCCGG + Intronic
1151304688 17:73255747-73255769 CATCACCCCCTAGGTGATGCTGG + Intronic
1151757044 17:76080958-76080980 TATCATCTCACAGCTGAAGCAGG - Intronic
1152385935 17:79974784-79974806 CACCAACTCACAGGTGGGGCTGG + Intronic
1152456838 17:80421680-80421702 CATCATCTCATAGGTGAGGCAGG + Intronic
1152727372 17:81954264-81954286 GATGATCTCATGGGAGAGGCAGG + Exonic
1156133350 18:34005558-34005580 CATAATCTCAAAACTGAGGCTGG + Intronic
1157133749 18:45034022-45034044 CAGCTTCTCTAAGGTGAGGCTGG + Intronic
1159438178 18:68445074-68445096 CCTCCTCTCATAGCTGAAGCTGG - Intergenic
1163443388 19:17333091-17333113 CTTCACCTCCCAGGTGAGGCCGG - Exonic
1163495415 19:17643836-17643858 CATGATCTGATGGGGGAGGCAGG - Intronic
1163495712 19:17645538-17645560 CATAATCTGATGGGGGAGGCAGG - Intronic
1163533585 19:17864413-17864435 CAACACCCCACAGGTGAGGCTGG - Intergenic
1165964590 19:39565129-39565151 CATCATCTCATAGTAGAAGGAGG + Intergenic
1166253085 19:41584807-41584829 CATCATCACATAGTGGAGACTGG + Intronic
1166918293 19:46211173-46211195 CTCCATGTCATAGGAGAGGCTGG - Intergenic
925494063 2:4426326-4426348 CCTCACCTCATGGGTGAGGCCGG + Intergenic
925652974 2:6111789-6111811 CATCATTGCATAGGAGAGCCTGG - Intergenic
925743337 2:7024838-7024860 CATAATATCATAGATGAGGCAGG + Intronic
926166926 2:10526920-10526942 CTTCATCTCAAACGTGAGGCTGG + Intergenic
929947388 2:46381397-46381419 CAGCATCTTATAGCTGAGGAAGG + Intronic
932688611 2:73893896-73893918 CATCTCTTCACAGGTGAGGCAGG + Intronic
932737565 2:74265094-74265116 CCACAGATCATAGGTGAGGCAGG - Exonic
932750743 2:74370127-74370149 CATCAACTGATAGGAGAGTCAGG + Intronic
934119398 2:88825445-88825467 CATCAGCACACAGGTGAGCCGGG + Intergenic
935930269 2:108116700-108116722 CAGCATCTCATTGGTGATGAGGG - Intergenic
936162865 2:110097968-110097990 CATCAGCACACAGGTGAGCCGGG + Intronic
937963471 2:127482269-127482291 CTTCATGTCATAGTTGAGGCTGG - Intronic
941024201 2:160440277-160440299 CTTCATCTCCTATCTGAGGCAGG + Intronic
1168892725 20:1305435-1305457 CAGCTTCTCATAGGTGTTGCTGG - Exonic
1169157168 20:3341463-3341485 CATCATCACAGAGGAGAGGAGGG - Intronic
1171191979 20:23165283-23165305 AATCATCTCCTGGGGGAGGCTGG + Intergenic
1172702640 20:36862724-36862746 CAGCATCTCCTCGGTGAGGTCGG + Exonic
1172885212 20:38226405-38226427 CAACATGTCCTAGGTGATGCCGG - Intronic
1175786728 20:61716606-61716628 CTTCATCTAATAGCTGAGGTTGG + Intronic
1176045369 20:63089836-63089858 CGCCATCCCATGGGTGAGGCCGG - Intergenic
1176282515 20:64322269-64322291 CAGACTCTCAGAGGTGAGGCCGG - Intergenic
1178261001 21:31099559-31099581 CACCATCTTAGAGGTGAGGGAGG - Intergenic
1179441659 21:41399087-41399109 CCTCATCTCATGGGTGAAGAAGG - Intronic
1183429922 22:37759252-37759274 CTACATCTCACAGGTAAGGCCGG + Exonic
1184929690 22:47671935-47671957 CATCAGGTCATAGCTGAGACTGG - Intergenic
953708056 3:45246020-45246042 CATTATCACATGGATGAGGCTGG - Intergenic
954337478 3:49928204-49928226 CAGCATCTCCTAGGTCAGTCTGG + Intronic
961484293 3:127206651-127206673 GAGCATCTCACAGGGGAGGCTGG - Intergenic
961620509 3:128220489-128220511 CATACTCTCAGAGGTGCGGCTGG + Intronic
962074911 3:132071330-132071352 CACCATCTCAAAAGTGAGGATGG - Intronic
966339435 3:178909052-178909074 AATCATCAGAAAGGTGAGGCCGG + Intergenic
969376758 4:6768256-6768278 AATCATCTCAGAGACGAGGCCGG - Intergenic
969467448 4:7366166-7366188 CGTCATCTCGAAGGTGAGGAAGG + Intronic
971535710 4:27748018-27748040 CAGTATCTCCTTGGTGAGGCAGG - Intergenic
973801909 4:54486864-54486886 CTTCATTTGATTGGTGAGGCTGG + Intergenic
974442271 4:61934695-61934717 CAGCATGTCACAGGGGAGGCTGG + Intronic
982561454 4:156932984-156933006 CATCATCACATGGTAGAGGCAGG + Intronic
983547195 4:168976663-168976685 CATCTTCTCAAAGGTGTGGAGGG + Intronic
984583498 4:181536380-181536402 CGTCATCTCAGAGCTGGGGCAGG - Intergenic
986125951 5:4882498-4882520 CCTCATCCCATTGGTGAGGGAGG - Intergenic
986327339 5:6686086-6686108 CATCATAGCAAAGGTGAGGCAGG + Intergenic
988783131 5:34541692-34541714 CATCTTAACATAAGTGAGGCAGG - Intergenic
990517504 5:56544074-56544096 CATCATTTCCCAAGTGAGGCTGG - Intronic
992442737 5:76811104-76811126 CTTCATCTCATTGGGCAGGCTGG + Intergenic
994191859 5:96877642-96877664 CATGATCACGTAGGTGAGGTTGG + Intronic
996837050 5:127804911-127804933 CAGCATTTCACAGATGAGGCTGG + Intergenic
997146299 5:131437752-131437774 CATCCTCACATAGCTGAGACTGG - Intronic
997233099 5:132257815-132257837 CACCATCTCACGGGTGAGTCTGG + Exonic
997876942 5:137558052-137558074 CATCAGTTCAAAGGTGAGGAGGG + Intronic
1000125349 5:158238363-158238385 CATTATCTCATTTATGAGGCAGG - Intergenic
1000444404 5:161302161-161302183 CATCATCACATGGGTCAGTCTGG - Intronic
1000930223 5:167242562-167242584 CATCTTCTCATAGAGTAGGCTGG - Intergenic
1001242882 5:170083518-170083540 AATCTTCTCATAGATGAGGTGGG - Intergenic
1004830193 6:19468477-19468499 CATGATCTGAGAGGTGAGTCAGG + Intergenic
1006145068 6:31954107-31954129 CATCTTTTCATAGGTGACGAAGG + Exonic
1007256773 6:40535218-40535240 CATCATCTCATTTGACAGGCAGG - Intronic
1010635286 6:78251788-78251810 CAGCTACTCAGAGGTGAGGCAGG - Intergenic
1015482010 6:133722772-133722794 TAACATCTCATAGGCTAGGCTGG - Intergenic
1015897237 6:138029133-138029155 CATCATCTGATGGGCGAGTCGGG - Intergenic
1020958461 7:14772735-14772757 CATCAGCTGATAGTTGAGGATGG + Intronic
1022315370 7:29240360-29240382 CTCCATCTCTTAGGTGAGACAGG + Intronic
1023656467 7:42427253-42427275 CTACATCTCATCTGTGAGGCTGG - Intergenic
1023923807 7:44650427-44650449 CATCACCTCATCTGTAAGGCAGG + Intronic
1024545334 7:50512962-50512984 CATCATGGCATATGGGAGGCAGG + Intronic
1027396255 7:77757764-77757786 CATCATCCCACAGGTTAGCCTGG + Intronic
1034048450 7:147955671-147955693 CATCATATGATAGCTGAGGTGGG - Intronic
1039842126 8:41301597-41301619 CATCAACTCTTAAGTGAGGAGGG + Intronic
1047374051 8:124279308-124279330 CATCATCTGATTTGTGAGGTAGG - Intergenic
1049519218 8:143079770-143079792 CGTCCTCCCACAGGTGAGGCTGG - Intergenic
1050150969 9:2619243-2619265 CAGCATCTGGTAGGGGAGGCAGG - Intergenic
1051042801 9:12834305-12834327 AACCATTTCATAAGTGAGGCAGG - Intergenic
1053338854 9:37304355-37304377 CAAAATCTCAAGGGTGAGGCTGG + Intronic
1061382457 9:130266430-130266452 CACCATTTCATAGGTGGGGCCGG - Intergenic
1061403633 9:130382057-130382079 CCTCATTTCACAGATGAGGCAGG + Intronic
1190362011 X:49658382-49658404 CAGCATCTCAGAGGAGTGGCTGG + Intergenic
1195341331 X:103909301-103909323 CATCATCTCAAAGCTGAGGTTGG - Intergenic
1195690146 X:107617543-107617565 CTTCATCTTGTAGGTCAGGCTGG - Intergenic