ID: 1152456839

View in Genome Browser
Species Human (GRCh38)
Location 17:80421681-80421703
Sequence ATCATCTCATAGGTGAGGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 163
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 154}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152456829_1152456839 25 Left 1152456829 17:80421633-80421655 CCACCACCAATTTGCAGGGTACA 0: 1
1: 0
2: 1
3: 9
4: 124
Right 1152456839 17:80421681-80421703 ATCATCTCATAGGTGAGGCAGGG 0: 1
1: 0
2: 1
3: 7
4: 154
1152456832_1152456839 -8 Left 1152456832 17:80421666-80421688 CCTTCTTCCAAACCCATCATCTC 0: 1
1: 0
2: 4
3: 31
4: 417
Right 1152456839 17:80421681-80421703 ATCATCTCATAGGTGAGGCAGGG 0: 1
1: 0
2: 1
3: 7
4: 154
1152456830_1152456839 22 Left 1152456830 17:80421636-80421658 CCACCAATTTGCAGGGTACATCT 0: 1
1: 0
2: 1
3: 8
4: 94
Right 1152456839 17:80421681-80421703 ATCATCTCATAGGTGAGGCAGGG 0: 1
1: 0
2: 1
3: 7
4: 154
1152456831_1152456839 19 Left 1152456831 17:80421639-80421661 CCAATTTGCAGGGTACATCTTCT 0: 1
1: 0
2: 0
3: 13
4: 220
Right 1152456839 17:80421681-80421703 ATCATCTCATAGGTGAGGCAGGG 0: 1
1: 0
2: 1
3: 7
4: 154
1152456825_1152456839 30 Left 1152456825 17:80421628-80421650 CCTGCCCACCACCAATTTGCAGG 0: 1
1: 0
2: 0
3: 16
4: 191
Right 1152456839 17:80421681-80421703 ATCATCTCATAGGTGAGGCAGGG 0: 1
1: 0
2: 1
3: 7
4: 154
1152456828_1152456839 26 Left 1152456828 17:80421632-80421654 CCCACCACCAATTTGCAGGGTAC 0: 1
1: 0
2: 1
3: 8
4: 90
Right 1152456839 17:80421681-80421703 ATCATCTCATAGGTGAGGCAGGG 0: 1
1: 0
2: 1
3: 7
4: 154

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152456839 Original CRISPR ATCATCTCATAGGTGAGGCA GGG Intronic
900702591 1:4057627-4057649 TTCATCTCCTATGTGAGGGATGG + Intergenic
903855609 1:26336327-26336349 TTCGTCTCAAAGGTAAGGCAGGG - Exonic
904371457 1:30050093-30050115 ATCATCTCACAGATGAACCACGG + Intergenic
904839211 1:33360833-33360855 TTCATTTGACAGGTGAGGCATGG + Intronic
905222150 1:36455634-36455656 ATCCTCTGGTGGGTGAGGCAGGG + Intergenic
906331990 1:44893343-44893365 ATCCTGACATAGCTGAGGCAAGG + Intronic
906510376 1:46407227-46407249 ATCATCTCAGAGGGCAGGAAGGG + Intronic
906838106 1:49105996-49106018 ATCATTTCTTAAGTGAGACAAGG + Intronic
912534097 1:110350922-110350944 ATAATGTCATATTTGAGGCATGG + Intergenic
912600039 1:110921180-110921202 ATCATCTGGTAGGTGAGTAAAGG + Intergenic
912651052 1:111439919-111439941 ATCATGTCAAGGGTGAAGCATGG + Exonic
919144528 1:193617127-193617149 ATCATCTAAGTGGGGAGGCAGGG - Intergenic
921936153 1:220799046-220799068 ATCATCTCATTGTTCAGGCAAGG - Intronic
924894851 1:248325365-248325387 ACCATGTGATAGGGGAGGCAGGG + Intergenic
1063045885 10:2392350-2392372 ATCAGCTGACAGGTGAGGAAGGG + Intergenic
1063105780 10:2990764-2990786 AACATGACATAGGTGAGACATGG - Intergenic
1064198805 10:13267257-13267279 ATCTTCACAAATGTGAGGCAGGG - Intergenic
1065882985 10:30053109-30053131 ATCATCTCATAAGTGAATAATGG - Intronic
1067914879 10:50386758-50386780 TCCATCTCACAGGTGGGGCAGGG - Intronic
1071759554 10:88585214-88585236 ATCATCTCAACGGTGAAGCAAGG + Intergenic
1071890316 10:89999471-89999493 AACATCTCATAGGTGGGGGTTGG - Intergenic
1075056209 10:119220542-119220564 AACATTTCAGAGGCGAGGCATGG + Intronic
1075346118 10:121682946-121682968 ATGTTCTCAAAGGTCAGGCACGG + Intergenic
1075609419 10:123839922-123839944 AACATCTCAGAGGGAAGGCAAGG - Intronic
1075705058 10:124495503-124495525 TTCATCTCACAGGTGTGGCTGGG + Intronic
1076662894 10:132067317-132067339 CTCAACTCACAGGAGAGGCAGGG - Intergenic
1078433641 11:11306980-11307002 ATCATCTCACAGGCTAGGCCAGG - Intronic
1078527676 11:12112443-12112465 AGCTTCTCAGAGGTGAGGCCAGG - Intronic
1079839397 11:25376836-25376858 ATCATTTCAGTGGTGAGTCAGGG - Intergenic
1079909886 11:26296639-26296661 ATCATCCAACAGGTGAGACATGG + Intergenic
1080684929 11:34507367-34507389 TCCATTTCATAGGTGAGGGATGG + Intronic
1083032787 11:59609182-59609204 ATCATCTGATAGGTGACTGATGG + Intronic
1083604240 11:63968165-63968187 ATCCACTTATAGGTCAGGCACGG + Intergenic
1084999091 11:73012941-73012963 ATCATCTCATATTTGAACCAAGG - Intronic
1086428172 11:86707639-86707661 TTCATGTCAGAGGTGAGTCAAGG - Intergenic
1102600361 12:114025110-114025132 CTCATCTCAAAGGTGTGGAAAGG - Intergenic
1105762745 13:23528892-23528914 CTCATCTGTTTGGTGAGGCACGG + Intergenic
1107955913 13:45511082-45511104 ATCTTCCCAGAGGTGTGGCATGG - Intronic
1110483822 13:76015097-76015119 CTCATCTGGTCGGTGAGGCAGGG + Intergenic
1112107408 13:96256297-96256319 ATCATCTCAAAAGTGTGGCGAGG + Intronic
1112709530 13:102111422-102111444 ATTGTCTCATGGGTTAGGCATGG + Intronic
1112968007 13:105223138-105223160 ATCAACACCTGGGTGAGGCATGG + Intergenic
1115323773 14:32114402-32114424 ATAACCTCAAAGTTGAGGCAGGG - Intronic
1115891218 14:38030936-38030958 ATGATCTCAGATGAGAGGCAAGG + Intronic
1116030348 14:39563738-39563760 AACATCTCAGAGGAGAGGAAAGG - Intergenic
1117611154 14:57484703-57484725 ATGAGCTGAGAGGTGAGGCAGGG + Intronic
1121563982 14:94894980-94895002 CTCAACTCATAGATGAGGAAGGG - Intergenic
1122881454 14:104692254-104692276 TTCATTTCACAGGTGAGGCGCGG + Intronic
1124698082 15:31883688-31883710 ATCATGTCATCTGTGAGTCAAGG + Intergenic
1124699947 15:31904101-31904123 TTCATCCCATAGGTGAAGCAAGG + Intergenic
1128820755 15:70650700-70650722 AACATCACATATGTGAGGCACGG - Intergenic
1129670106 15:77602986-77603008 ATCATCTTATAGATGGGGAAAGG + Intergenic
1132477677 16:149461-149483 ATCATCTCATATCTCAGGCATGG + Intergenic
1134635947 16:15791962-15791984 ATCATATAAAAGGTCAGGCATGG - Intronic
1138909142 16:61375316-61375338 AAAAACTCATAGGTGAGGGAGGG + Intergenic
1139972370 16:70784102-70784124 ATCATCTCCTGGGTAAGGCCTGG - Exonic
1141817831 16:86425070-86425092 TTCATCCCATTCGTGAGGCAGGG - Intergenic
1146720356 17:35119564-35119586 ATCATCTCCTCGGTAAGGCCAGG + Exonic
1146964900 17:37017951-37017973 ATGATTTTGTAGGTGAGGCATGG - Intronic
1148455065 17:47806915-47806937 ATTCTCTCATAGCTGAGGCCAGG + Intergenic
1149170622 17:53806401-53806423 ATCATCTCATACATAATGCAAGG - Intergenic
1149574024 17:57698412-57698434 AGCCTCACATAGCTGAGGCAGGG - Intergenic
1149968245 17:61189813-61189835 GTCATCTCATAGGTGCATCAAGG - Intronic
1152456839 17:80421681-80421703 ATCATCTCATAGGTGAGGCAGGG + Intronic
1154135364 18:11773100-11773122 CTCATCTCAGAGGTCAGGGAAGG - Intronic
1155122561 18:22837925-22837947 ATCTTCTCATATGTCAGGAAGGG - Intronic
1155383140 18:25246737-25246759 ATCCTCTCTTAGGTGGGGAAAGG - Intronic
1156113841 18:33762038-33762060 GTCTTCTAATAGCTGAGGCAAGG + Intergenic
1156745815 18:40389698-40389720 CTCATCTGGTAGGTGATGCAGGG - Intergenic
1159881955 18:73866617-73866639 ATCATACCATACATGAGGCATGG - Intergenic
1161899060 19:7104262-7104284 TTCATCTCATTGTTTAGGCACGG + Intergenic
1161956142 19:7496350-7496372 AACAACACACAGGTGAGGCATGG - Intronic
1163495414 19:17643835-17643857 ATGATCTGATGGGGGAGGCAGGG - Intronic
1163495711 19:17645537-17645559 ATAATCTGATGGGGGAGGCAGGG - Intronic
1165854559 19:38871636-38871658 ATGAACACACAGGTGAGGCACGG - Exonic
1167014893 19:46834756-46834778 ATCATTTAATATGTGGGGCATGG - Intergenic
1167399058 19:49252764-49252786 ATCACCACAGAGGTGAGGCCCGG - Intergenic
925325650 2:3020035-3020057 AACATCTCATAGGTGAGGCCAGG - Intergenic
928021882 2:27711940-27711962 GTCATGACATGGGTGAGGCAAGG - Intronic
931361762 2:61583933-61583955 AGCATCTCATAGGCCAGGCGTGG + Intergenic
932737564 2:74265093-74265115 CACAGATCATAGGTGAGGCAGGG - Exonic
932798244 2:74716110-74716132 CTCTTCTCTTAGGTGAAGCATGG + Intergenic
934981561 2:98847499-98847521 ATCACCTCATAGGAGTGGGATGG - Intronic
935737127 2:106115183-106115205 CTCATCTCAGATCTGAGGCAAGG + Intronic
937963470 2:127482268-127482290 TTCATGTCATAGTTGAGGCTGGG - Intronic
938819544 2:134941998-134942020 ATCAACCCTTAGGTGTGGCAGGG - Intronic
942571345 2:177318066-177318088 CTAATCTCACAAGTGAGGCATGG - Intronic
943978511 2:194514423-194514445 ATCATGTCATTCGTGAGTCAAGG + Intergenic
1170453679 20:16512261-16512283 CTCATTTTATAGGTTAGGCAAGG + Intronic
1171191980 20:23165284-23165306 ATCATCTCCTGGGGGAGGCTGGG + Intergenic
1172288737 20:33759572-33759594 ATCATCTCATCGGCCAGGCACGG - Intronic
1174339181 20:49885284-49885306 AGCATCTCATAGGTATGGTATGG + Intronic
1174700077 20:52599396-52599418 ATTATCTCCTGGATGAGGCAGGG - Intergenic
1176292439 21:5053224-5053246 ATCATAACATAAGTCAGGCATGG + Intergenic
1176343064 21:5716032-5716054 ATGATATCAAAGGTGAGGCCTGG - Intergenic
1176475318 21:7148183-7148205 ATGATATCAAAGGTGAGGCCTGG - Intergenic
1176501763 21:7608424-7608446 ATGATATCAAAGGTGAGGCCTGG + Intergenic
1176537385 21:8114101-8114123 ATGATATCAAAGGTGAGGCCTGG - Intergenic
1179441658 21:41399086-41399108 CTCATCTCATGGGTGAAGAAGGG - Intronic
1179864818 21:44210426-44210448 ATCATAACATAAGTCAGGCATGG - Intergenic
1181869256 22:25885236-25885258 CCCATCTCACAGATGAGGCAAGG + Intronic
1181895064 22:26099887-26099909 ATCATCTCCTACGGGTGGCAAGG + Intergenic
1203242329 22_KI270733v1_random:30457-30479 ATGATATCAAAGGTGAGGCCTGG - Intergenic
950726472 3:14920364-14920386 ATCATTTATTAGGTGGGGCATGG + Intronic
955672814 3:61419402-61419424 ATCATCTCATTGGTCTGGCTTGG - Intergenic
956500216 3:69874754-69874776 ATCATGTCAAAGGTGAGGGGTGG + Intronic
960654955 3:119992882-119992904 CTAATCTCATAGGTGAGAAATGG - Intronic
961484292 3:127206650-127206672 AGCATCTCACAGGGGAGGCTGGG - Intergenic
963352836 3:144173744-144173766 ATAATCTCATGTGTGAGTCATGG + Intergenic
964792049 3:160461497-160461519 ATCATCTTAAAAATGAGGCAGGG - Intronic
966339436 3:178909053-178909075 ATCATCAGAAAGGTGAGGCCGGG + Intergenic
969376757 4:6768255-6768277 ATCATCTCAGAGACGAGGCCGGG - Intergenic
969609818 4:8220675-8220697 AGCATCTCATTGGTGGGGCCAGG - Intronic
977995418 4:103494071-103494093 AAAATCTCAGAGGTGAGGCCAGG + Intergenic
981027096 4:140087795-140087817 ATCATGTCATAGGTGGAGGAAGG + Intronic
986327340 5:6686087-6686109 ATCATAGCAAAGGTGAGGCAGGG + Intergenic
990466859 5:56078921-56078943 TTCATTTCATAGGTTAGGGAGGG + Intergenic
990964535 5:61431079-61431101 ATCATCTTATGGGTCGGGCATGG + Intronic
992150570 5:73898369-73898391 ATCATATCAAAAATGAGGCAGGG - Intronic
995651676 5:114376790-114376812 ATCATCTCATTGGCCAGCCATGG + Intronic
998264470 5:140657605-140657627 ATCCTTTCATACCTGAGGCAGGG + Exonic
1001095027 5:168769363-168769385 CTCATGTCAGAGGTCAGGCAGGG - Intronic
1001242881 5:170083517-170083539 ATCTTCTCATAGATGAGGTGGGG - Intergenic
1004830194 6:19468478-19468500 ATGATCTGAGAGGTGAGTCAGGG + Intergenic
1008662221 6:53679871-53679893 ACCATCTCATAGCTCAAGCAAGG + Intergenic
1008768496 6:54949405-54949427 ACCAACTCATCGGTCAGGCATGG - Intergenic
1011496222 6:87939271-87939293 ATCATCTCAGAGGTAATTCATGG + Intergenic
1011876061 6:91963759-91963781 ATCTTCTCATTGGTGAGAAATGG - Intergenic
1014743771 6:125175719-125175741 ATCATTTCATAGGGGAAGCTAGG - Intronic
1017486374 6:154905602-154905624 ATCATCCCAGAGGCCAGGCATGG + Intronic
1020605186 7:10327986-10328008 TTAATCTCTTAGGTGAGGCCAGG - Intergenic
1022983378 7:35625662-35625684 GCCATCTCCAAGGTGAGGCAGGG + Intergenic
1023923808 7:44650428-44650450 ATCACCTCATCTGTAAGGCAGGG + Intronic
1026259682 7:68744233-68744255 ATCATCATATAGGTGGGGCCAGG - Intergenic
1028979809 7:96954799-96954821 TACATCTCCTAGGAGAGGCAGGG + Intergenic
1030330591 7:108266010-108266032 ATCAGTTCATAGGTGGGGGAAGG - Intronic
1030537371 7:110785651-110785673 TTCCTCTCATTGGTGATGCAAGG - Intronic
1037878588 8:22561616-22561638 CTCATCTTATAGATGAGGAAAGG - Intronic
1041674886 8:60527914-60527936 ACCATTTTATAGGTGAGGAAAGG + Intronic
1042323673 8:67505144-67505166 ATCATCTCATAGGATATGAATGG - Intronic
1044683932 8:94809290-94809312 ATCATCTTAGAGGCCAGGCATGG + Intergenic
1047816110 8:128464830-128464852 ATAATTTCAAGGGTGAGGCAGGG - Intergenic
1048207463 8:132426623-132426645 ATCATTCCATTGGTGAGGGAAGG - Intronic
1050873263 9:10602958-10602980 TTCACCTCATATGAGAGGCATGG - Intronic
1052144283 9:25027710-25027732 ATAATTTAATAGGTAAGGCATGG - Intergenic
1052972223 9:34383873-34383895 AGGATTTCAAAGGTGAGGCAAGG - Intronic
1053045854 9:34916497-34916519 ATCATCTTATAAATGAGGAAAGG + Intergenic
1056303205 9:85263257-85263279 ATTTCCTCATAGGTGAGACAGGG + Intergenic
1057719691 9:97522015-97522037 ATCATTTCACAGATGAGCCACGG + Intronic
1058419172 9:104818506-104818528 ATCATATCATACTTAAGGCATGG - Intronic
1060752600 9:126183242-126183264 ATCATTTCATAGGCAATGCAAGG - Intergenic
1061324130 9:129852528-129852550 GTCTTCTCATAGGTGAGCCCAGG + Exonic
1061403634 9:130382058-130382080 CTCATTTCACAGATGAGGCAGGG + Intronic
1062393689 9:136344048-136344070 AGCAGCTGATAGGTGAGGAACGG + Intronic
1203458657 Un_GL000220v1:13534-13556 ATGATATCAAAGGTGAGGCCTGG - Intergenic
1185892401 X:3833245-3833267 ACCATCTCAAGGGTGAGGCTAGG - Intronic
1185897509 X:3871664-3871686 ACCATCTCAAGGGTGAGGCTAGG - Intergenic
1185902628 X:3910096-3910118 ACCATCTCAAGGGTGAGGCTAGG - Intergenic
1189204915 X:39229635-39229657 ATAATCCCCTAGGTGAGGGATGG - Intergenic
1191972046 X:66827504-66827526 GTTATCTCCTAGTTGAGGCAGGG - Intergenic
1195341330 X:103909300-103909322 ATCATCTCAAAGCTGAGGTTGGG - Intergenic
1195373319 X:104201276-104201298 AGAATCTCAAAGGTGAGGCCTGG + Intergenic
1199004457 X:142678647-142678669 ATGATCTCATAGATGAGAAATGG + Intergenic