ID: 1152456840

View in Genome Browser
Species Human (GRCh38)
Location 17:80421685-80421707
Sequence TCTCATAGGTGAGGCAGGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 324
Summary {0: 1, 1: 0, 2: 1, 3: 31, 4: 291}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152456830_1152456840 26 Left 1152456830 17:80421636-80421658 CCACCAATTTGCAGGGTACATCT 0: 1
1: 0
2: 1
3: 8
4: 94
Right 1152456840 17:80421685-80421707 TCTCATAGGTGAGGCAGGGAAGG 0: 1
1: 0
2: 1
3: 31
4: 291
1152456831_1152456840 23 Left 1152456831 17:80421639-80421661 CCAATTTGCAGGGTACATCTTCT 0: 1
1: 0
2: 0
3: 13
4: 220
Right 1152456840 17:80421685-80421707 TCTCATAGGTGAGGCAGGGAAGG 0: 1
1: 0
2: 1
3: 31
4: 291
1152456828_1152456840 30 Left 1152456828 17:80421632-80421654 CCCACCACCAATTTGCAGGGTAC 0: 1
1: 0
2: 1
3: 8
4: 90
Right 1152456840 17:80421685-80421707 TCTCATAGGTGAGGCAGGGAAGG 0: 1
1: 0
2: 1
3: 31
4: 291
1152456829_1152456840 29 Left 1152456829 17:80421633-80421655 CCACCACCAATTTGCAGGGTACA 0: 1
1: 0
2: 1
3: 9
4: 124
Right 1152456840 17:80421685-80421707 TCTCATAGGTGAGGCAGGGAAGG 0: 1
1: 0
2: 1
3: 31
4: 291
1152456832_1152456840 -4 Left 1152456832 17:80421666-80421688 CCTTCTTCCAAACCCATCATCTC 0: 1
1: 0
2: 4
3: 31
4: 417
Right 1152456840 17:80421685-80421707 TCTCATAGGTGAGGCAGGGAAGG 0: 1
1: 0
2: 1
3: 31
4: 291

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152456840 Original CRISPR TCTCATAGGTGAGGCAGGGA AGG Intronic
900074389 1:801387-801409 ACTCGAGGGTGAGGCAGGGAGGG - Intergenic
900476982 1:2880516-2880538 GCTGGTGGGTGAGGCAGGGAAGG + Intergenic
900833365 1:4980741-4980763 TCCCTTGGGTAAGGCAGGGATGG + Intergenic
902310464 1:15577995-15578017 TTTTACAGGTGAGGAAGGGAGGG + Intronic
902718626 1:18289888-18289910 TCAAATGGGTGAGGCGGGGATGG + Intronic
902816835 1:18921248-18921270 TCCCAGAGGGCAGGCAGGGATGG - Intronic
903013189 1:20344446-20344468 ACTCATGGGTAAGGAAGGGATGG - Intronic
904356965 1:29946536-29946558 ATTCATTGGTGAGGCAGGGAAGG + Intergenic
904679094 1:32216319-32216341 CCTCATGGGTGGGGCAGGCAAGG + Exonic
904754477 1:32760525-32760547 GCTCATGGGTGAGGAAGGCAGGG + Intronic
906070237 1:43011063-43011085 TCAAATGGGTGTGGCAGGGAGGG + Intergenic
906798059 1:48713144-48713166 TCTGGTAGGTGAGACAGGGAGGG + Intronic
907068904 1:51517269-51517291 TCTCATATGTGAGGCACTGAAGG + Intronic
907481565 1:54748583-54748605 TCTCATCGATGAGGCAGGGGAGG - Intergenic
907545744 1:55258498-55258520 TCTCCTATGTGAGGCAGGGGAGG - Intergenic
907644924 1:56232759-56232781 ACTCATAGCTGATGCAGTGATGG - Intergenic
907647631 1:56260047-56260069 TATCGTTGGTAAGGCAGGGAAGG - Intergenic
908452475 1:64269617-64269639 TCTCCTACCTGAGGGAGGGAGGG + Intergenic
910115225 1:83724434-83724456 TCTCAGAGCTTATGCAGGGAAGG + Intergenic
910549074 1:88455557-88455579 TTTCTTAGGTGAGGAGGGGAGGG - Intergenic
910711801 1:90189863-90189885 TCTCACAGGGAAGGCGGGGAAGG - Intergenic
911847421 1:102772018-102772040 TCTGAGAGATGAGGCAGGGTGGG - Intergenic
912735654 1:112147217-112147239 TCTCAGAAGGCAGGCAGGGAAGG - Intergenic
915394461 1:155572236-155572258 TGTCACAGCTGAGGGAGGGAAGG - Intergenic
915524097 1:156465799-156465821 TCCCATACTTGATGCAGGGAAGG - Exonic
915626677 1:157118165-157118187 TCTCATCTGTCAGACAGGGATGG + Intergenic
916748705 1:167704420-167704442 TATCATAGGTGAGGCAATGAAGG - Intronic
917063713 1:171068636-171068658 TGTAATAGGTGAGGCAGAGGAGG + Intergenic
917265723 1:173218560-173218582 CCTCATATCTGGGGCAGGGATGG - Intergenic
918151324 1:181799969-181799991 TCTCAGAGGAGTGGCAGGGAAGG - Intronic
920508035 1:206530808-206530830 GCTCATAGGGGAGCCATGGAAGG + Intronic
920593704 1:207247874-207247896 TCTCTTATATGAGTCAGGGAGGG + Intergenic
921072256 1:211670910-211670932 GCACATAGGTCAGGCAGGTAAGG - Intronic
921149355 1:212387177-212387199 CCTCCTTGGTGAGGCAGGCAAGG - Intronic
921276003 1:213520655-213520677 TCTCATGGGTTTGGTAGGGAAGG - Intergenic
922270238 1:224026291-224026313 ACTCGAGGGTGAGGCAGGGAGGG - Intergenic
922813046 1:228428749-228428771 TCCCAAAGGTGACGCAGAGAAGG - Intergenic
923273673 1:232379018-232379040 TCTCATACGTGAGCTGGGGAGGG + Intergenic
924044569 1:240013836-240013858 TTTCACAGGTGAGGCAGCTAAGG + Intergenic
924046950 1:240041596-240041618 ACCCATAGGAGAGGCAGAGAAGG - Intronic
924183680 1:241464769-241464791 TCTCAAAGCTCAGGCAGGAAAGG - Intergenic
1063135261 10:3210667-3210689 TCTCATAGATGAGGCTGAGAAGG + Intergenic
1063468675 10:6266419-6266441 TCTTAGAGCTGAGACAGGGAAGG - Intergenic
1064172646 10:13047685-13047707 TCTCATAGGGAGGGCACGGATGG - Intronic
1067170840 10:43904594-43904616 TTGCAGAGGGGAGGCAGGGAAGG - Intergenic
1067569998 10:47364798-47364820 TGTCTCAGGTGAGGCAGGAAAGG - Intergenic
1069822492 10:71236352-71236374 TGTTTTAGGTGAGGCAGGGCGGG - Intronic
1070096759 10:73344986-73345008 TCTTAGAGGTGAGGAAGAGATGG + Intronic
1070256069 10:74813961-74813983 TCTCAGAGGCGAGGCGGGGGTGG - Intergenic
1073293775 10:102425992-102426014 TGCCATAGGTTAGTCAGGGAAGG - Intronic
1075090847 10:119443596-119443618 TCTCATAGATGAGGCAGCCAAGG - Exonic
1075932762 10:126313359-126313381 TCTCCTTTGTGAGGCAGGGTTGG - Intronic
1077009448 11:373685-373707 TCAAATAGTGGAGGCAGGGAAGG - Intronic
1077158729 11:1103076-1103098 TCCCATGGGTGAGCCAGTGAAGG - Intergenic
1078431629 11:11292674-11292696 TCTCACAGCTGGGGCAGGGCTGG - Intronic
1079122958 11:17698243-17698265 TTTTATAGATGAGGAAGGGAAGG - Intergenic
1079924202 11:26472417-26472439 TTTCATAGGTGAGGAAATGAAGG + Intronic
1080383874 11:31799165-31799187 TTTCAAAAGTCAGGCAGGGATGG + Intronic
1080920815 11:36707773-36707795 TCTGATGAGTGAGGGAGGGAGGG - Intergenic
1081841195 11:46202582-46202604 TCTGCCAGGTGAGGCAGAGAGGG - Intergenic
1084433752 11:69126174-69126196 TCTCAAAAGGGAGGCAGGCAGGG + Intergenic
1084601548 11:70148806-70148828 ACTTGTATGTGAGGCAGGGATGG - Intronic
1085015197 11:73169451-73169473 TCTCAGAGCTGAGGCAGGCAGGG + Intergenic
1085201408 11:74704445-74704467 TCCAATCTGTGAGGCAGGGAAGG - Intronic
1085321031 11:75574150-75574172 TCTAAGAGGGGAGGCAGGCAGGG - Intergenic
1087342890 11:96931128-96931150 TTTCATCGGGGAGGCGGGGAGGG - Intergenic
1090746179 11:129706705-129706727 TTCCATGGGTGTGGCAGGGAAGG - Intergenic
1091088462 11:132746565-132746587 TCTCGTGGGTGAGGCCGGGGAGG - Intronic
1091995038 12:4986793-4986815 TCTCACAGGAGAGCCTGGGAAGG + Intergenic
1092262635 12:6960686-6960708 TCTCACAGGTGACGCAGCCACGG - Exonic
1094220986 12:27993170-27993192 TGTGATAGGTGATGCAGTGATGG + Intergenic
1095978340 12:47955097-47955119 GCTCAGAGGTGAGGCAGTCAGGG + Intergenic
1096694398 12:53339297-53339319 TCTCCTAGGGGAGGGTGGGAAGG - Intronic
1101364552 12:104059738-104059760 TCTCATTATTGAGGCTGGGAAGG - Intronic
1102234464 12:111285651-111285673 TCCCCAGGGTGAGGCAGGGAGGG - Intronic
1103101392 12:118179325-118179347 TCTCATGGGGGTGGCAGGAAAGG + Intronic
1103966664 12:124644476-124644498 CCTCTAAGGAGAGGCAGGGAAGG + Intergenic
1104578737 12:129993126-129993148 TGTCATCAGTGAGGCAGGGATGG + Intergenic
1106304028 13:28494765-28494787 TCTCACAGGTGAGGCGCGGCTGG - Exonic
1107427757 13:40311303-40311325 ACTTAAAGGTGAGGCAGAGAAGG + Intergenic
1110534208 13:76632011-76632033 TCTCTTAGTGGAGGCAGGAAAGG - Intergenic
1110736712 13:78945654-78945676 TTTCATAGGGTAGCCAGGGAAGG - Intergenic
1113833124 13:113312568-113312590 TCCCATAGGGGAGGCTTGGAAGG + Intronic
1114735296 14:25037342-25037364 TGTCAGAGGAGAGGCAGGGTAGG + Intronic
1114913870 14:27236900-27236922 TATCTTTGGTGAGGAAGGGAGGG - Intergenic
1116436174 14:44897456-44897478 ACTCATAGATGAGGCAGCGGCGG + Exonic
1117299636 14:54412030-54412052 GCTAATAAGTGAGGCAGTGATGG - Intronic
1119178388 14:72586748-72586770 TCTCATGGGTAAGGCAGACAAGG - Intergenic
1119687559 14:76644808-76644830 CCTCACAGCTGAGGCAGGGGAGG + Intergenic
1120706373 14:87750319-87750341 GCACATAGGTCAGGAAGGGAGGG - Intergenic
1120734138 14:88034622-88034644 CCTCAGAAGTCAGGCAGGGAAGG - Intergenic
1120961179 14:90126356-90126378 GCTCCTAGGTGAGGCAGCGTTGG - Intronic
1122049449 14:99045651-99045673 TTTTAAAGGTAAGGCAGGGAGGG + Intergenic
1122154005 14:99739497-99739519 TCTCCTAGATGGGGAAGGGATGG - Intronic
1123038662 14:105481560-105481582 GCTCACAGGAGAGGCTGGGATGG + Intergenic
1124098506 15:26671032-26671054 TCTCATAGATTAGCCAGGCATGG - Intronic
1124424907 15:29555730-29555752 TCTCAGAGGGGAGTTAGGGAGGG - Intronic
1126357128 15:47808445-47808467 TCTCATAGGTGAGGAAAACAAGG - Intergenic
1126940851 15:53763444-53763466 TCTCAAAGGTTAGGCAGAAAAGG - Intergenic
1128221124 15:65969408-65969430 TCCCATGGGTCAGGGAGGGATGG + Intronic
1128660592 15:69498117-69498139 TCTCACAGGAAAGGCAGGGGTGG - Intergenic
1129671076 15:77607928-77607950 TCTCATCTGTGAAGCAGGCACGG - Intergenic
1130948908 15:88570313-88570335 TCTCTTAAGTGTGGCAGGCAGGG + Intergenic
1131045979 15:89315857-89315879 TTTCAAAGGTGGTGCAGGGATGG - Intronic
1131666472 15:94576438-94576460 TTGCAGAGGTGAGGCAGGGCTGG - Intergenic
1131970884 15:97891751-97891773 TCTCCTAGATGAGGCAGGCAGGG + Intergenic
1132634777 16:938362-938384 GCTCACAGGGAAGGCAGGGATGG + Intronic
1133283812 16:4681374-4681396 GCTGATGGCTGAGGCAGGGAGGG + Intronic
1133773484 16:8881245-8881267 TTTTACAGATGAGGCAGGGAGGG + Intergenic
1133908098 16:10039722-10039744 CCTCATTGCTGAGGGAGGGAGGG - Intronic
1134647278 16:15879358-15879380 TCTCAGAGGCCAGGCATGGAGGG + Intronic
1134812461 16:17179228-17179250 TCTCCTTGAGGAGGCAGGGAGGG + Intronic
1135071650 16:19357318-19357340 GCTAATAGGTGAGTCAGGGTAGG - Intergenic
1135109854 16:19682172-19682194 TCCCAAAGATGAAGCAGGGAGGG - Intronic
1135138096 16:19899384-19899406 CCTCCTGGGTCAGGCAGGGATGG - Intergenic
1137542867 16:49377095-49377117 TCTCGCAGGGGAGGCAGGGAGGG - Intronic
1138584657 16:57962162-57962184 TCTCAGAGCTGACTCAGGGAGGG - Intronic
1138909144 16:61375320-61375342 ACTCATAGGTGAGGGAGGGGTGG + Intergenic
1139447022 16:67004270-67004292 TACCATAGTGGAGGCAGGGAAGG + Intronic
1140272444 16:73479139-73479161 TGTCATTGGTAAGGAAGGGAGGG - Intergenic
1140555328 16:75915259-75915281 TCTTCTAGGTGAGGGATGGAAGG - Intergenic
1141503289 16:84459379-84459401 GCGCAGAGGTGAGGCAGGGCCGG + Exonic
1141700325 16:85639330-85639352 CCTGGTAGGAGAGGCAGGGAGGG - Intronic
1142157702 16:88540128-88540150 TCTCAGAGGTGAGCCAGGCAGGG + Intergenic
1142534591 17:605569-605591 TCATATTGGTGAGTCAGGGACGG + Intronic
1142534629 17:605705-605727 TCATATTGGTGAGTCAGGGACGG + Intronic
1143974012 17:10816750-10816772 TCTAAGAGCTGAGGCAGGGGTGG - Intergenic
1144888093 17:18477560-18477582 TCTCAGAGGTGACGGAGGCAGGG + Intronic
1145144112 17:20466743-20466765 TCTCAGAGGTGACGGAGGCAGGG - Intronic
1145934244 17:28705693-28705715 TGTCAGAGGTGAGGCAGTGGTGG - Intronic
1146125627 17:30229071-30229093 CCCGATGGGTGAGGCAGGGAGGG - Intronic
1148327005 17:46789209-46789231 TATCAGGTGTGAGGCAGGGAGGG - Intronic
1148693587 17:49546384-49546406 CCTCAGAGGTGATGGAGGGAAGG - Intergenic
1149334022 17:55616921-55616943 TATCATGGTTGAGGCAGGAATGG - Intergenic
1149574022 17:57698408-57698430 TCACATAGCTGAGGCAGGGATGG - Intergenic
1151541927 17:74768981-74769003 TCACATGGGGGAGGAAGGGAGGG - Exonic
1151683695 17:75634859-75634881 TCACAGAAGTGAGGCTGGGAGGG + Intronic
1152386442 17:79977567-79977589 TCTCACAGGTGGGGGAAGGAAGG - Intronic
1152456840 17:80421685-80421707 TCTCATAGGTGAGGCAGGGAAGG + Intronic
1152571777 17:81124186-81124208 CAGCAGAGGTGAGGCAGGGAGGG + Intronic
1152727375 17:81954269-81954291 TCTCATGGGAGAGGCAGGCGGGG + Exonic
1203165925 17_GL000205v2_random:95430-95452 GTTCATAGATGAGTCAGGGAAGG + Intergenic
1153825398 18:8869791-8869813 TCTCATAAATCAGCCAGGGAGGG + Intergenic
1154389223 18:13922325-13922347 CTTCATTGGTGAGGCAAGGAGGG - Intergenic
1155020528 18:21892815-21892837 TTTGAGAAGTGAGGCAGGGATGG - Intergenic
1158946198 18:62449089-62449111 TCTCAGAGGTGATGGAGGGCAGG - Intergenic
1160042449 18:75358282-75358304 TATCATGCGTGAGGGAGGGAGGG + Intergenic
1160117056 18:76089448-76089470 TCTCATGGGAAAGGCAGGGATGG - Intergenic
1162803184 19:13122345-13122367 TCTCATGGCTGAGACAGGGGTGG - Intronic
1164225909 19:23245726-23245748 TCTCAAAGGTTAGGCAGACAAGG - Intronic
1165121282 19:33560467-33560489 TCTCATAGAAGAGGTGGGGATGG + Intergenic
1165312060 19:35034366-35034388 GCTCTCAGGTGAGGCAGTGAAGG + Intronic
1165356522 19:35307848-35307870 TCTCATGGGTGAGGAAGGGCCGG + Intronic
1167037723 19:47004010-47004032 TCTCATAGGAAAGGATGGGAGGG - Exonic
925925005 2:8663871-8663893 TCTGATAGGATAGGCAGGGGTGG + Intergenic
926743349 2:16130249-16130271 TCTTGAAGGAGAGGCAGGGATGG - Intergenic
927494621 2:23544118-23544140 TCTGGTGGGTGGGGCAGGGAAGG + Intronic
927692632 2:25219218-25219240 GTTCAAATGTGAGGCAGGGATGG + Intergenic
929399331 2:41561947-41561969 TTTCATGAGTGAGGCAAGGAGGG - Intergenic
930843248 2:55871628-55871650 TTTCATGGCTGGGGCAGGGAAGG + Intronic
931809036 2:65836316-65836338 TCTTAAAGCTGAGGTAGGGAGGG - Intergenic
931878505 2:66540987-66541009 TCAGATAAGTGAGGCAGGGAGGG + Intronic
935274796 2:101466839-101466861 TCTCATACATGAGACAGCGAGGG + Exonic
936393333 2:112096414-112096436 TCTCAGAGGTCAGGCAGAAAAGG - Intronic
936476259 2:112842651-112842673 GCTGATATGTGAGGAAGGGATGG - Intergenic
937226872 2:120375293-120375315 TCTCCTTGGGGAGGCAGTGAGGG - Intergenic
937920015 2:127122294-127122316 TCTCCTTGGGGAGGCAGTGAGGG - Intergenic
938060759 2:128252633-128252655 TCTCATGGGTCAGGAAGGAAAGG - Intronic
938338726 2:130521318-130521340 TCTCCTGGCTGAGGAAGGGAAGG + Exonic
938351114 2:130599432-130599454 TCTCCTGGCTGAGGAAGGGAAGG - Exonic
941052466 2:160750005-160750027 ACTCATAGAAGAGACAGGGAAGG - Intergenic
942135264 2:172919095-172919117 TCTCCTGGCTGAGCCAGGGATGG + Intronic
946237330 2:218332249-218332271 TCTCACAGGTGAGGCTGCGCTGG + Intronic
947403053 2:229747992-229748014 TCTCACAGGTGAGGCAGTTGAGG - Intergenic
948056176 2:235010751-235010773 TCTCCTAGGAGAGGGAGGAAGGG - Intronic
948056183 2:235010775-235010797 TCTCCTAGGAGAGGGAGGAAGGG - Intronic
948056194 2:235010820-235010842 TCTCCTAGGAGAGGGAGGAAGGG - Intronic
948056201 2:235010844-235010866 TCTCCTAGGAGAGGGAGGAAGGG - Intronic
948056212 2:235010889-235010911 TCTCCTAGGAGAGGGAGGAAGGG - Intronic
948056265 2:235011117-235011139 TCTCCTAGGAGAGGGAGGAAGGG - Intronic
948056272 2:235011141-235011163 TCTCCTAGGAGAGGGAGGAAGGG - Intronic
948056279 2:235011165-235011187 TCTCCTAGGAGAGGGAGGAAGGG - Intronic
948852138 2:240713636-240713658 TCCCAGTGATGAGGCAGGGAGGG - Intergenic
1168892723 20:1305430-1305452 TCTCATAGGTGTTGCTGGCAGGG - Exonic
1169035095 20:2443992-2444014 TCTCGTTGGTGAGTAAGGGATGG - Intergenic
1169782768 20:9327035-9327057 TCTCATCTGTAAGGTAGGGATGG + Intronic
1170372797 20:15667960-15667982 ATTCATAAGTGAGGCAGGCACGG + Intronic
1170835213 20:19878201-19878223 GAGCATGGGTGAGGCAGGGAGGG - Intergenic
1172058029 20:32167770-32167792 CCTGATGGGTGAGGCAGGGAGGG + Intergenic
1172798627 20:37560773-37560795 TCTGACAGCTGGGGCAGGGAGGG - Intergenic
1173296537 20:41764188-41764210 TCTGGTAGTTGAGGCAGGGATGG + Intergenic
1173555988 20:43966157-43966179 TTTTATAGGTGAGGAAAGGAAGG + Intronic
1173728297 20:45311990-45312012 TTTCCCAGGAGAGGCAGGGATGG - Intronic
1173924586 20:46771317-46771339 GCTCCTGGGTGAGGCTGGGATGG + Intergenic
1174493433 20:50920685-50920707 TCTCATACCTAAGGCAGTGATGG - Intronic
1174950302 20:55035205-55035227 TCTCTTAGTTTAGGCAGAGAGGG + Intergenic
1175157226 20:56979280-56979302 TCTCTCAGGGGAGCCAGGGAGGG + Intergenic
1175293313 20:57892696-57892718 TCTCAGAGGTGAGGAGGGGAGGG + Intergenic
1176335596 21:5595117-5595139 GTTCATAGATGAGTCAGGGAAGG - Intergenic
1176392161 21:6225831-6225853 GTTCATAGATGAGTCAGGGAAGG + Intergenic
1176405828 21:6363666-6363688 GTTCATAGATGAGTCAGGGAAGG - Intergenic
1176469258 21:7090343-7090365 GTTCATAGATGAGTCAGGGAAGG - Intergenic
1176492819 21:7472121-7472143 GTTCATAGATGAGTCAGGGAAGG - Intergenic
1176507823 21:7666262-7666284 GTTCATAGATGAGTCAGGGAAGG + Intergenic
1178536359 21:33413356-33413378 GCTCATAGGTGTGGAGGGGAGGG + Intronic
1178563590 21:33662242-33662264 ACTCATAGCTGCGGCAGGTACGG - Intronic
1180913557 22:19469987-19470009 TCTTATAGGTGAGCCACAGAAGG + Intronic
1181362806 22:22351612-22351634 TCATATAGATGAGGCAGGGAAGG - Intergenic
1182698182 22:32210218-32210240 GCTCACAGCTGGGGCAGGGATGG - Intergenic
1182836009 22:33341887-33341909 TCTCAAAGATGGGGCAGGGAAGG + Intronic
1183352756 22:37343228-37343250 TCCCATAAGTGAGGCAGGTGGGG + Intergenic
1184037460 22:41925595-41925617 TCTTCTAGGGGAGGGAGGGAAGG - Intronic
1184887527 22:47355436-47355458 GCTCTGAGGTGTGGCAGGGATGG + Intergenic
950306815 3:11921635-11921657 TCTTTTAGGTGAGACAGGAAGGG + Intergenic
950674769 3:14548115-14548137 ACTCAAAGGTGAGGTAGGCAGGG + Intergenic
951099646 3:18672242-18672264 TCTCATTGGTGCAGAAGGGAGGG - Intergenic
951225159 3:20112219-20112241 TACTATAGCTGAGGCAGGGATGG - Intronic
953529569 3:43727992-43728014 TCTCATAGATGAGACAGAAATGG - Intronic
954124381 3:48520146-48520168 CCTCATCTGTGGGGCAGGGAAGG + Intronic
955467959 3:59255892-59255914 TATCATGGGTGGGGCAGTGAGGG + Intergenic
956938053 3:74126369-74126391 TCTCATACTTGGGGCAGAGAAGG + Intergenic
962047513 3:131776284-131776306 TCTCATAGGTCAGGAAGCCAAGG + Intronic
965124829 3:164612585-164612607 TCTCCTAGTATAGGCAGGGAGGG - Intergenic
965568929 3:170151733-170151755 GCTCCTAGTGGAGGCAGGGAAGG + Intronic
966377072 3:179307200-179307222 TCTGACAGCTGAGTCAGGGAAGG + Intergenic
968232041 3:197009984-197010006 TCTCACAGGGGACGCAGGCAGGG - Intronic
968941262 4:3639967-3639989 TGGCACAGGTGAGCCAGGGAAGG + Intergenic
969374458 4:6754059-6754081 TTTCATAGGAGAGGCAGACAAGG - Intergenic
970312038 4:14792956-14792978 GCTCATAGGAGAGGCATGGTGGG + Intergenic
970375973 4:15457318-15457340 TCTCATAGATGTGGTAGGGAAGG - Intergenic
971014242 4:22470917-22470939 CCTGACAGGTGAGGCAGGCAGGG + Intronic
971648664 4:29242019-29242041 TAACATAAGTGGGGCAGGGAAGG + Intergenic
972575185 4:40344892-40344914 TCTGACTGGAGAGGCAGGGAAGG + Intronic
973725305 4:53769847-53769869 TGTCAAAAGAGAGGCAGGGAGGG - Intronic
976718813 4:88150873-88150895 TCTCATAGGCTATGGAGGGAGGG - Intronic
977237099 4:94521388-94521410 TGTCATAGGAGAGGAATGGAAGG + Intronic
979618309 4:122769515-122769537 TCACAAAGATGAGGGAGGGAGGG - Intergenic
980308112 4:131091038-131091060 TCTCATAAGTGAGGAAGAGCAGG - Intergenic
981512601 4:145574079-145574101 TCTCATAGGTGAGGTCGTAATGG + Intergenic
981803927 4:148690944-148690966 TCTGATAGGTCAGCCCGGGAAGG + Intergenic
983409742 4:167381133-167381155 CCTCATGGGGGAGGGAGGGAAGG - Intergenic
983729550 4:170976294-170976316 TCACATAAGAGAGGCAGGGTTGG + Intergenic
984810472 4:183791897-183791919 TGGTATAGGTGGGGCAGGGAGGG + Intergenic
985867689 5:2528105-2528127 TACCAGAGGTGAGGGAGGGAAGG + Intergenic
986327341 5:6686091-6686113 TAGCAAAGGTGAGGCAGGGCAGG + Intergenic
991124686 5:63055806-63055828 TCTCAAAGGTTAGGCAGAAAAGG - Intergenic
992290816 5:75277714-75277736 TGTCTTAGGTGAGGCAGGCAGGG - Intergenic
992557470 5:77917373-77917395 TCTCTGGGGTGAGGCAGGGGAGG + Intergenic
993903889 5:93602831-93602853 TACCATAAGCGAGGCAGGGAGGG - Intergenic
994149744 5:96433587-96433609 TCTCATGTGTGTGGCGGGGAGGG + Intronic
995445459 5:112237768-112237790 GCCCAGAGGTTAGGCAGGGATGG - Intronic
997392621 5:133529375-133529397 TCTCATAGGGAAGACAGAGAAGG - Intronic
997476956 5:134148393-134148415 GCTCTCAGGTGAGGCAGGCAGGG - Intronic
1001095025 5:168769359-168769381 TGTCAGAGGTCAGGCAGGGAGGG - Intronic
1001948332 5:175797922-175797944 TCTGAGAGCTGAGGCTGGGAGGG + Intronic
1002540266 5:179902215-179902237 TCTCAGAGGAGCGGGAGGGAAGG + Intronic
1010083481 6:71888565-71888587 CCTCATAGGAGAGGAATGGAGGG + Intronic
1011860879 6:91754364-91754386 TCTAAAAAGAGAGGCAGGGAAGG - Intergenic
1012033899 6:94107453-94107475 ACTCAGAGGGGAGGGAGGGAAGG + Intergenic
1012249900 6:96968664-96968686 TCTGAGAGGTGGGGAAGGGAGGG - Intronic
1013969399 6:115998596-115998618 TCTCTGAGGGGAGTCAGGGAAGG - Intronic
1016861240 6:148720898-148720920 TCTTATAGGAAAGGCAGGGGAGG - Intergenic
1017486954 6:154911813-154911835 TCTCAAAGGTGAGGCCTGGCTGG + Intronic
1017760495 6:157564214-157564236 ACTCATAGTTGGGGCAGGGCGGG + Intronic
1017940581 6:159049315-159049337 TCTTAGAGGAGAGGCAGGCAAGG - Intergenic
1019172785 6:170143623-170143645 TCTCACAGCTGAGCCACGGAGGG - Intergenic
1021959326 7:25856973-25856995 TCTCAGGGTTGAGGCAGCGAAGG - Intergenic
1021992998 7:26154502-26154524 TCTCCCAGGTGATGCCGGGAGGG - Intronic
1022774096 7:33506546-33506568 TCCCATAGGTAAAACAGGGATGG - Intronic
1023341680 7:39227964-39227986 TATTTTAGGTGAGGAAGGGAAGG + Intronic
1026876268 7:73880761-73880783 TCCCATCGGAGAGGAAGGGAAGG + Intergenic
1027529071 7:79307512-79307534 TCCCATAGATGATGCAGGTAGGG - Intronic
1028979811 7:96954803-96954825 TCTCCTAGGAGAGGCAGGGGAGG + Intergenic
1029225266 7:99022407-99022429 ACTCAGAGGTGAAACAGGGAAGG + Intergenic
1029322824 7:99780252-99780274 TCTCATGGTGGAGGCAGGAAAGG - Intronic
1030740278 7:113101298-113101320 TCACAGAGGTTAGGCAGGGAGGG - Intergenic
1033978092 7:147126761-147126783 TCTCATTGGTGGGCCAGGCATGG - Intronic
1034329958 7:150273869-150273891 TCTCACAGAGGAGTCAGGGAAGG - Intronic
1034668100 7:152835991-152836013 TCTCACAGAGGAGTCAGGGAAGG + Intronic
1034988764 7:155534243-155534265 TCTCAGAGCAGAGACAGGGAAGG - Intergenic
1035541253 8:440092-440114 ACTCGAGGGTGAGGCAGGGAGGG + Intronic
1036728626 8:11242403-11242425 TCTCATGGGTCAGGAAGGAAAGG - Intergenic
1037717405 8:21411936-21411958 TCACATGGGGGAGGCAGGGCTGG - Intergenic
1039627653 8:39071146-39071168 TATCATGTGTGAGGCAGGAAAGG + Intronic
1040704524 8:50109793-50109815 TCTGAAAGGTGAGGCAGAGTGGG + Intronic
1041397344 8:57405055-57405077 TCTCAGAGGTGGGGGAGGGAGGG + Intergenic
1047281931 8:123453320-123453342 ATTCTTAGGTGAGGCAAGGAAGG - Intronic
1048925554 8:139267830-139267852 TCTGAGAGGAGAGGAAGGGATGG - Intergenic
1050247542 9:3706817-3706839 TCTCATGGTTCAGGCAGGCAAGG - Intergenic
1054766462 9:69046525-69046547 TCTAATGGGAGAGGCAGGGAAGG - Intronic
1055107030 9:72523658-72523680 TGTCTTAGGGGTGGCAGGGATGG + Intronic
1055231770 9:74074845-74074867 GCACATAGGTGGGGCAGCGATGG + Intergenic
1055554747 9:77462808-77462830 CCGAAAAGGTGAGGCAGGGATGG - Intronic
1056383782 9:86078936-86078958 ACTCACAGGAAAGGCAGGGAGGG + Intronic
1056581649 9:87891037-87891059 CCTCATAGGGGAGTCAGAGAAGG - Intergenic
1056834507 9:89943620-89943642 CCCCAAAGGTGGGGCAGGGAGGG - Intergenic
1057706998 9:97401924-97401946 TTTCATAAATGGGGCAGGGAGGG + Intergenic
1057765344 9:97912096-97912118 TCTCATAGGTGAGGAAACTAGGG - Intronic
1058654147 9:107204420-107204442 TCTCATAGGTGAGCAAGAAAAGG + Intergenic
1058718950 9:107746371-107746393 TTTCATGTGAGAGGCAGGGAGGG - Intergenic
1060055416 9:120408899-120408921 TGTCAAGGGTGAGTCAGGGAAGG - Intronic
1060829844 9:126706396-126706418 CCTCAGAGATGGGGCAGGGAAGG - Intergenic
1060920931 9:127419770-127419792 CCTCAGAGCTGAGGCAAGGACGG + Intergenic
1061382455 9:130266425-130266447 TTTCATAGGTGGGGCCGGTAAGG - Intergenic
1061661321 9:132132224-132132246 CCTGGCAGGTGAGGCAGGGATGG + Intergenic
1062376161 9:136262828-136262850 TCTCCTCTGTAAGGCAGGGAGGG - Intergenic
1203426043 Un_GL000195v1:39785-39807 GTTCATAGATGAGTCAGGGAAGG + Intergenic
1185478505 X:429222-429244 CCCCATCTGTGAGGCAGGGACGG + Intergenic
1187941939 X:24391167-24391189 GCTCCCAGGGGAGGCAGGGAGGG + Intergenic
1188902171 X:35747000-35747022 TCTCAGAGGTGAGGAGTGGAAGG + Intergenic
1190626655 X:52343807-52343829 TCTAGTAGTTGAGGCAGGGTAGG + Intergenic
1190701356 X:52992022-52992044 TCTAGTAGTTGAGGCAGGGTAGG - Intronic
1191662400 X:63665216-63665238 TCTCCTTTGTGAGGCTGGGAAGG - Intronic
1191912024 X:66161427-66161449 TGTTCTAGGTAAGGCAGGGAAGG - Intergenic
1192231650 X:69269455-69269477 TCCCAGATGTGAGGCAGTGAGGG - Intergenic
1192357748 X:70419827-70419849 TCTCATAGATAATGCAGAGAAGG - Intronic
1192446717 X:71216441-71216463 ACTCACAGGTGAGGCAATGAAGG - Intronic
1193938373 X:87651160-87651182 TATCTTAGGTGAGGCAGGTAGGG + Intronic
1197694398 X:129535404-129535426 TAACATAGATGAGGCTGGGAAGG - Intergenic
1198307432 X:135396948-135396970 TATCATTGGTGAAGCAGGTATGG - Intergenic
1198500634 X:137242627-137242649 TTTCATGGCTGGGGCAGGGAAGG + Intergenic
1198962290 X:142195454-142195476 GCTCAAAGTTGAGGCGGGGAAGG + Intergenic
1201531126 Y:14990700-14990722 TGTAATAGGTGAGGTAGGAAAGG - Intergenic
1202129592 Y:21597806-21597828 GCGCATTCGTGAGGCAGGGAAGG + Intergenic