ID: 1152456841

View in Genome Browser
Species Human (GRCh38)
Location 17:80421686-80421708
Sequence CTCATAGGTGAGGCAGGGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 333
Summary {0: 1, 1: 0, 2: 0, 3: 24, 4: 308}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152456830_1152456841 27 Left 1152456830 17:80421636-80421658 CCACCAATTTGCAGGGTACATCT 0: 1
1: 0
2: 1
3: 8
4: 94
Right 1152456841 17:80421686-80421708 CTCATAGGTGAGGCAGGGAAGGG 0: 1
1: 0
2: 0
3: 24
4: 308
1152456832_1152456841 -3 Left 1152456832 17:80421666-80421688 CCTTCTTCCAAACCCATCATCTC 0: 1
1: 0
2: 4
3: 31
4: 417
Right 1152456841 17:80421686-80421708 CTCATAGGTGAGGCAGGGAAGGG 0: 1
1: 0
2: 0
3: 24
4: 308
1152456831_1152456841 24 Left 1152456831 17:80421639-80421661 CCAATTTGCAGGGTACATCTTCT 0: 1
1: 0
2: 0
3: 13
4: 220
Right 1152456841 17:80421686-80421708 CTCATAGGTGAGGCAGGGAAGGG 0: 1
1: 0
2: 0
3: 24
4: 308
1152456829_1152456841 30 Left 1152456829 17:80421633-80421655 CCACCACCAATTTGCAGGGTACA 0: 1
1: 0
2: 1
3: 9
4: 124
Right 1152456841 17:80421686-80421708 CTCATAGGTGAGGCAGGGAAGGG 0: 1
1: 0
2: 0
3: 24
4: 308
1152456834_1152456841 -10 Left 1152456834 17:80421673-80421695 CCAAACCCATCATCTCATAGGTG 0: 1
1: 0
2: 0
3: 13
4: 142
Right 1152456841 17:80421686-80421708 CTCATAGGTGAGGCAGGGAAGGG 0: 1
1: 0
2: 0
3: 24
4: 308

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152456841 Original CRISPR CTCATAGGTGAGGCAGGGAA GGG Intronic
900313084 1:2043810-2043832 CACCCAGGGGAGGCAGGGAAGGG - Intergenic
900476983 1:2880517-2880539 CTGGTGGGTGAGGCAGGGAAGGG + Intergenic
900954265 1:5877007-5877029 ATCATGTGGGAGGCAGGGAAAGG + Intronic
901107508 1:6768654-6768676 TTCATGGGTGTGGCAGGAAATGG + Intergenic
902189225 1:14749753-14749775 CTCCCAGGAGAGGCAGGAAATGG - Intronic
902797588 1:18809415-18809437 TTTATAGATGAGGCATGGAAAGG - Intergenic
903654667 1:24942014-24942036 CTCAGAGGTGAGGCAGTGAGAGG - Intronic
904993656 1:34614144-34614166 CACAGAGGTGAGAGAGGGAATGG - Intergenic
905918018 1:41699285-41699307 CTCAAAGGAGGGGCAGGGCAGGG + Intronic
905970473 1:42138090-42138112 CACAGAGCTGAGGGAGGGAAGGG - Intergenic
907383115 1:54107922-54107944 CTCAGAGGTGAAGAAGGGGATGG + Intronic
907644923 1:56232758-56232780 CTCATAGCTGATGCAGTGATGGG - Intergenic
907647630 1:56260046-56260068 ATCGTTGGTAAGGCAGGGAAGGG - Intergenic
909524901 1:76612117-76612139 CAAAAAGGGGAGGCAGGGAAAGG - Intronic
910711800 1:90189862-90189884 CTCACAGGGAAGGCGGGGAAGGG - Intergenic
910859965 1:91733555-91733577 CTCATAGACAAGACAGGGAAGGG - Intronic
911296050 1:96116283-96116305 ATCATAGCTGAGGCAGAGAGAGG - Intergenic
911367002 1:96950551-96950573 AATGTAGGTGAGGCAGGGAAAGG + Intergenic
911770531 1:101735403-101735425 CACATGGGAGAGACAGGGAATGG + Intergenic
912759388 1:112353603-112353625 AACAAAAGTGAGGCAGGGAAGGG - Intergenic
913516437 1:119609418-119609440 CTCCTGGTTGAGCCAGGGAATGG - Intergenic
915394460 1:155572235-155572257 GTCACAGCTGAGGGAGGGAAGGG - Intergenic
915795712 1:158731540-158731562 CTCATAGTTGAGCCTGGGCAAGG - Intergenic
916068459 1:161155400-161155422 ATCAAATGTGAGGCAGGGAATGG + Intronic
917063714 1:171068637-171068659 GTAATAGGTGAGGCAGAGGAGGG + Intergenic
918074719 1:181161378-181161400 CGCAAAGGAGAGGCAGGGAGCGG + Intergenic
918339320 1:183554282-183554304 CTCACAGGTCATCCAGGGAAAGG + Intronic
918456332 1:184720674-184720696 CTGATAGGTGAGCAAGGAAATGG + Intronic
921149354 1:212387176-212387198 CTCCTTGGTGAGGCAGGCAAGGG - Intronic
923109840 1:230881996-230882018 CGAAAAGCTGAGGCAGGGAATGG + Intergenic
923342491 1:233019648-233019670 CTCAGAGGGGAGGCAGGCAGTGG + Intronic
924183679 1:241464768-241464790 CTCAAAGCTCAGGCAGGAAAGGG - Intergenic
924468013 1:244315478-244315500 AGCATGGGTGAGGCAGGGTAAGG + Intergenic
924894853 1:248325370-248325392 GTGATAGGGGAGGCAGGGATTGG + Intergenic
924929985 1:248721930-248721952 CTCTTAGGGGAGGCAGGGCCAGG + Intronic
1063045888 10:2392355-2392377 CTGACAGGTGAGGAAGGGGAGGG + Intergenic
1063786370 10:9389454-9389476 CTCAAAGGAGAGCCAGGGGAGGG + Intergenic
1064272269 10:13876167-13876189 CTTATTGGAGAGGAAGGGAAGGG - Intronic
1064562795 10:16609269-16609291 CTCCTAGGTGAGGCAGTGCCAGG - Intronic
1065629199 10:27660140-27660162 CTCAGAGGTGAGACAGGGTCCGG + Intergenic
1067170839 10:43904593-43904615 TGCAGAGGGGAGGCAGGGAAGGG - Intergenic
1067531933 10:47080513-47080535 CTCCTAGGGGAGGCTGGGCATGG - Intergenic
1067569997 10:47364797-47364819 GTCTCAGGTGAGGCAGGAAAGGG - Intergenic
1070647055 10:78209255-78209277 CCCAGAGGTGAGGGAGGCAATGG - Intergenic
1070957170 10:80471797-80471819 CACCTAGGTGAGGCAGGGCCTGG - Intronic
1073293774 10:102425991-102426013 GCCATAGGTTAGTCAGGGAAGGG - Intronic
1076918628 10:133440010-133440032 CTCCTCTGTGAGCCAGGGAAAGG - Intergenic
1077009447 11:373684-373706 CAAATAGTGGAGGCAGGGAAGGG - Intronic
1078217293 11:9322143-9322165 GTCATAGGTGAGGCCGGGCGTGG - Intergenic
1080503643 11:32892760-32892782 CTCAGAGGGGAGGCGGGGCAAGG + Intergenic
1080574806 11:33588481-33588503 CTCATCGGGGAGGCCTGGAAAGG + Intronic
1080961297 11:37163694-37163716 CTCAGAGTTGAGGGAGGTAACGG - Intergenic
1083024427 11:59538001-59538023 ATCATGGATGAGACAGGGAAAGG - Intergenic
1083204971 11:61143198-61143220 CTCACAGGGGAGGCTGGGAGAGG + Intronic
1084367148 11:68709274-68709296 CTCTTGGCTGAGGCAGGGCACGG + Intronic
1084601547 11:70148805-70148827 CTTGTATGTGAGGCAGGGATGGG - Intronic
1085015198 11:73169452-73169474 CTCAGAGCTGAGGCAGGCAGGGG + Intergenic
1085201406 11:74704444-74704466 CCAATCTGTGAGGCAGGGAAGGG - Intronic
1087927076 11:103930986-103931008 CTCCTAGATGAGGCAAGAAAGGG - Intronic
1091003984 11:131935391-131935413 CTCATAAGTGAAGTAGGAAAAGG - Intronic
1091561379 12:1616582-1616604 CTCATCGGTGAGGAAGGAACTGG + Intronic
1091679092 12:2513436-2513458 CTCATAGGAAAGGTAGTGAAAGG + Intronic
1091693464 12:2612282-2612304 CTCCTAGGAGAGGCAGGTGATGG + Intronic
1092110456 12:5958724-5958746 CACTTAGGGGAAGCAGGGAAAGG + Intronic
1094006071 12:25752917-25752939 CACTTAGGTGAGCCAGGGATAGG + Intergenic
1094181094 12:27593361-27593383 CTCATAGGATAGGAAGGGATAGG - Intronic
1094357882 12:29597531-29597553 CCCCAAGGTGAGGCAGGAAAGGG - Intronic
1095685499 12:45028963-45028985 CTCATGGGTGAGCCATGGGAAGG - Intronic
1096023111 12:48338516-48338538 CTCATAGGTGCGCCTGGGAGAGG + Exonic
1096602650 12:52741459-52741481 GTCAGAGCTGAAGCAGGGAATGG + Intergenic
1096694397 12:53339296-53339318 CTCCTAGGGGAGGGTGGGAAGGG - Intronic
1096804641 12:54133095-54133117 GTCAGAGGTGAGGGAGGGTAGGG + Intergenic
1097356984 12:58612917-58612939 CCCATAGGGTGGGCAGGGAAGGG - Intronic
1097706239 12:62871372-62871394 TGCATAGGGGAGGCAGAGAATGG + Intronic
1099474958 12:83096818-83096840 CTAATAGGTGAGGAAGGCAGAGG - Intronic
1101148835 12:101866413-101866435 GTCATAGGTGATTCAGGAAAAGG - Intergenic
1101776493 12:107799226-107799248 CTCAGCTGTCAGGCAGGGAAGGG - Intergenic
1101995591 12:109523039-109523061 GTCAGAGGTGAGGGAGGGAAAGG - Intronic
1102695336 12:114794626-114794648 CTCAGAAGTGAGGCCGGGCATGG + Intergenic
1103966665 12:124644477-124644499 CTCTAAGGAGAGGCAGGGAAGGG + Intergenic
1106373597 13:29161840-29161862 GTCAGAGGTGAGGCAGAGAGTGG - Intronic
1106483193 13:30152060-30152082 CACACAGGTGAGGCTGGGAGAGG - Intergenic
1107326227 13:39245826-39245848 CTCATGGGAGAGGCAGTGATTGG - Intergenic
1107427758 13:40311304-40311326 CTTAAAGGTGAGGCAGAGAAGGG + Intergenic
1108757709 13:53523742-53523764 TTAAGAGGTGAGGGAGGGAATGG - Intergenic
1110534207 13:76632010-76632032 CTCTTAGTGGAGGCAGGAAAGGG - Intergenic
1111753815 13:92367739-92367761 CTTACAAGTGAGGGAGGGAATGG - Intronic
1114215612 14:20655668-20655690 ATCAGAGGTGAGCCAGTGAATGG - Intergenic
1114735297 14:25037343-25037365 GTCAGAGGAGAGGCAGGGTAGGG + Intronic
1116074945 14:40099834-40099856 TTCATTGGTGGGGCAGGGGATGG + Intergenic
1117133306 14:52707182-52707204 CTCATAGGGGATGCCGGGAATGG - Exonic
1118650812 14:67892469-67892491 TTCATAGGTTATGCAGGCAAGGG + Intronic
1118993777 14:70819389-70819411 ATCATCGGTGTGGCAGGGCATGG - Intergenic
1119421023 14:74508182-74508204 CCCATAGGAGAGTCAGGGAGTGG + Intronic
1120541623 14:85758531-85758553 CTCATGTGTGATGCAGGAAAAGG + Intergenic
1120545911 14:85811139-85811161 ATCAGAGATGAGGCAGTGAAGGG + Intergenic
1120961178 14:90126355-90126377 CTCCTAGGTGAGGCAGCGTTGGG - Intronic
1121325744 14:93018674-93018696 CTCTTGGGTGAGGAAGGGGAAGG + Intronic
1122053321 14:99074921-99074943 CTCAGAGGTGAGGGAGGTAAAGG - Intergenic
1122179263 14:99943716-99943738 CTGGTGGGTTAGGCAGGGAAGGG + Intergenic
1122917609 14:104866038-104866060 GTCAGAGGTGAGGCGGGGAAAGG - Intronic
1123009928 14:105344205-105344227 TTAAAAGTTGAGGCAGGGAAGGG - Intronic
1202875976 14_KI270722v1_random:776-798 CTCAGAGGTGAGGGAGGAGAGGG - Intergenic
1125359301 15:38848849-38848871 CTCACAGGTGAGTAATGGAAAGG + Intergenic
1127365422 15:58284771-58284793 CACATCGGTGAGGCTGGGGAAGG + Intronic
1127488694 15:59441863-59441885 CTCAGAGGTGAGGCTGGGGCAGG - Intronic
1128767650 15:70260922-70260944 CTGAAAGGTGAGAAAGGGAAAGG + Intergenic
1130044672 15:80434727-80434749 AGCAGAGGAGAGGCAGGGAACGG + Intronic
1130229394 15:82085200-82085222 CTCTGAGGGGAGCCAGGGAAAGG + Intergenic
1130984081 15:88833411-88833433 AGCATAGGTGAGGCAGAGGAAGG - Intronic
1132634778 16:938363-938385 CTCACAGGGAAGGCAGGGATGGG + Intronic
1132685995 16:1162352-1162374 CCCACAGGTGAGGTGGGGAAAGG - Intronic
1132726996 16:1343190-1343212 CGGGTAGGTGAGGCAGCGAAAGG + Intronic
1133220710 16:4318050-4318072 CCCATTGGTGAGGGAGGGACTGG - Intronic
1133908097 16:10039721-10039743 CTCATTGCTGAGGGAGGGAGGGG - Intronic
1135138095 16:19899383-19899405 CTCCTGGGTCAGGCAGGGATGGG - Intergenic
1135304860 16:21359521-21359543 GTCATATGTTAGGCATGGAATGG + Intergenic
1135797197 16:25457018-25457040 GTCAAACGTGAGGCAGGGCAGGG + Intergenic
1137481990 16:48859460-48859482 CTCCTTGATGAAGCAGGGAATGG + Intergenic
1137499821 16:49002058-49002080 CACATAGTGGAGGGAGGGAAAGG - Intergenic
1138584426 16:57960824-57960846 CTCTGAGGTGAGCCAAGGAAGGG - Exonic
1138909145 16:61375321-61375343 CTCATAGGTGAGGGAGGGGTGGG + Intergenic
1139214925 16:65118301-65118323 CTCATAGGGGAGGCTGCGGATGG + Intronic
1139545062 16:67646175-67646197 CTCAAAGGTGACCTAGGGAAGGG - Exonic
1141309414 16:82898713-82898735 CTGATGGATGAAGCAGGGAATGG + Intronic
1142157703 16:88540129-88540151 CTCAGAGGTGAGCCAGGCAGGGG + Intergenic
1145952553 17:28830693-28830715 CTCATAGTTTAGGCCGGGCATGG + Intronic
1146647150 17:34582973-34582995 CTGGCAGGTGAGGAAGGGAAAGG - Intronic
1148572251 17:48679283-48679305 CTAACAGGGGAAGCAGGGAAAGG + Intergenic
1148693586 17:49546383-49546405 CTCAGAGGTGATGGAGGGAAGGG - Intergenic
1149425456 17:56550388-56550410 CACAGGGGTGAAGCAGGGAAAGG - Intergenic
1149574021 17:57698407-57698429 CACATAGCTGAGGCAGGGATGGG - Intergenic
1150510061 17:65742200-65742222 TGCAGAGGTGAGGCAGGAAAGGG + Intronic
1151796250 17:76347892-76347914 ATCAAAGATGAGGCAGGTAAAGG + Intronic
1152252484 17:79219183-79219205 CCCAGAGGTCAGGCTGGGAAGGG + Intronic
1152456841 17:80421686-80421708 CTCATAGGTGAGGCAGGGAAGGG + Intronic
1152571778 17:81124187-81124209 AGCAGAGGTGAGGCAGGGAGGGG + Intronic
1154148259 18:11884725-11884747 CCCTCAGGTGAGGCAGGGAACGG + Exonic
1154497520 18:14973308-14973330 CCCAGAGGTCAGGCAGGGCAGGG + Intergenic
1157302461 18:46488928-46488950 CTCAGGAGGGAGGCAGGGAATGG - Intronic
1157444612 18:47735287-47735309 GTCATAGGTGAGGTGGGGAGTGG - Intergenic
1157616152 18:48988899-48988921 CTGATAGGTGAGGGAGGCACTGG + Intergenic
1157746661 18:50141854-50141876 GAGAGAGGTGAGGCAGGGAATGG - Intronic
1159529174 18:69633894-69633916 ACCATTGGTGAGCCAGGGAAAGG - Intronic
1160065735 18:75572780-75572802 CTCACAGGGAAGCCAGGGAATGG - Intergenic
1160897440 19:1409258-1409280 CTTTGGGGTGAGGCAGGGAAAGG + Intronic
1161056801 19:2194824-2194846 CACAGAGGTGGTGCAGGGAATGG + Intronic
1161437566 19:4272981-4273003 CTGAGAGGTGGGGCAGGGCAGGG - Intergenic
1161514549 19:4689397-4689419 CTCCTGGGTAGGGCAGGGAAGGG - Intronic
1163128299 19:15256382-15256404 GGCATAGGGGAGGCAGGGGAAGG + Intronic
1163533582 19:17864407-17864429 CCCACAGGTGAGGCTGGAAAAGG - Intergenic
1164225908 19:23245725-23245747 CTCAAAGGTTAGGCAGACAAGGG - Intronic
1165312061 19:35034367-35034389 CTCTCAGGTGAGGCAGTGAAGGG + Intronic
1165333002 19:35151706-35151728 GTTTTAGGTGGGGCAGGGAAGGG + Intronic
1165356523 19:35307849-35307871 CTCATGGGTGAGGAAGGGCCGGG + Intronic
1165861525 19:38911773-38911795 CAGCTAGGTGAGGCAGGGCAAGG + Intronic
1166282045 19:41800699-41800721 CTCATCTGCCAGGCAGGGAAGGG + Intronic
1166506514 19:43374750-43374772 CTCACAGCTGAAGCAAGGAATGG - Intergenic
1166541421 19:43608231-43608253 CTCATCTGTGGGGAAGGGAAGGG - Intronic
1167712543 19:51121323-51121345 CTCAAAGCTGAGCCAGGCAAGGG - Intergenic
1167713324 19:51125432-51125454 GTCATGGGGGCGGCAGGGAAAGG + Intronic
926946208 2:18190141-18190163 TTGGTAGGTAAGGCAGGGAAGGG + Intronic
927692633 2:25219219-25219241 TTCAAATGTGAGGCAGGGATGGG + Intergenic
928385674 2:30865860-30865882 CATGTAGGTGAGGCAGGGGATGG + Intergenic
929589308 2:43134705-43134727 CTCAGAGGGGAGGCAGGGGCAGG - Intergenic
929593843 2:43163339-43163361 CTGACAGGAGAGGCAGAGAAGGG - Intergenic
932223995 2:70024656-70024678 AAAATAGGGGAGGCAGGGAAAGG - Intergenic
933379391 2:81523858-81523880 TTCTAAGGTGTGGCAGGGAAGGG + Intergenic
933774532 2:85764218-85764240 AGCATAGGGGAGGCAGGGACAGG + Intronic
934097399 2:88619279-88619301 ATGATAGGTGAGGCCGGGCACGG - Intronic
934925889 2:98381544-98381566 GTCATAGATGATGCAGGGGATGG + Intronic
935329058 2:101963051-101963073 GTCAAGGGTGAGGCAGGGACAGG - Intergenic
936060956 2:109295466-109295488 CTGGGAGGTGAGGCTGGGAAAGG + Intronic
936393332 2:112096413-112096435 CTCAGAGGTCAGGCAGAAAAGGG - Intronic
937475197 2:122208953-122208975 CTCATAAGTGAAGGAGAGAAAGG + Intergenic
938263081 2:129909046-129909068 CACAGAGGTGAGGCAGGGGCTGG - Intergenic
938338727 2:130521319-130521341 CTCCTGGCTGAGGAAGGGAAGGG + Exonic
938351113 2:130599431-130599453 CTCCTGGCTGAGGAAGGGAAGGG - Exonic
939202887 2:139061417-139061439 ATCATAAGTGAGGTAGGGTAAGG + Intergenic
939718181 2:145612066-145612088 CTCATAGCTGAGGTAAAGAATGG + Intergenic
939882636 2:147647565-147647587 CTGACAGGTCAGGCAGGTAATGG + Intergenic
940972440 2:159908229-159908251 CTCATAAATGATGCAGGCAATGG + Intergenic
941013989 2:160333583-160333605 CTCAGAAGGAAGGCAGGGAATGG + Intronic
941052465 2:160750004-160750026 CTCATAGAAGAGACAGGGAAGGG - Intergenic
944356946 2:198801532-198801554 CTCAGAAGTGGGGCAGGGCAAGG - Intergenic
946419904 2:219558817-219558839 ATCAGAGGCAAGGCAGGGAAAGG - Intronic
947174964 2:227356593-227356615 TTCATAGGAGAGGCATAGAAAGG + Intronic
948002150 2:234577079-234577101 CTTATATCTGAGGCAGGTAAAGG - Intergenic
1168775447 20:443634-443656 CTGATAGGTGAAGCAGTGAAAGG + Intronic
1170835212 20:19878200-19878222 AGCATGGGTGAGGCAGGGAGGGG - Intergenic
1171303080 20:24080682-24080704 CTGACTGGAGAGGCAGGGAATGG + Intergenic
1171798107 20:29582136-29582158 CTCAGTGGTCAGGCAGGGAGTGG - Intergenic
1172596939 20:36156105-36156127 CTCATAGGGGAGGCTGGCACAGG - Intronic
1172731267 20:37090463-37090485 CTCTTTAGTGTGGCAGGGAAAGG + Intronic
1172895938 20:38300039-38300061 CTGGTGGGTGAGGGAGGGAAAGG + Intronic
1173362901 20:42360320-42360342 CTCTCATGTGAGGCAGGGGAGGG - Intronic
1173924587 20:46771318-46771340 CTCCTGGGTGAGGCTGGGATGGG + Intergenic
1174217584 20:48928833-48928855 CTAATAGGGGAGGTAGAGAAAGG - Intronic
1175059417 20:56228237-56228259 CTCAAAAGTGAGCCAGGCAAAGG + Intergenic
1175293314 20:57892697-57892719 CTCAGAGGTGAGGAGGGGAGGGG + Intergenic
1175377450 20:58538575-58538597 ATCATAGGTGATGAAAGGAAAGG - Intergenic
1176358939 21:5976510-5976532 CTGATAGCAGAGGCTGGGAAGGG - Intergenic
1178536360 21:33413357-33413379 CTCATAGGTGTGGAGGGGAGGGG + Intronic
1178563589 21:33662241-33662263 CTCATAGCTGCGGCAGGTACGGG - Intronic
1179441656 21:41399081-41399103 CTCATGGGTGAAGAAGGGGAAGG - Intronic
1179764579 21:43562040-43562062 CTGATAGCAGAGGCTGGGAAGGG + Intronic
1180913558 22:19469988-19470010 CTTATAGGTGAGCCACAGAAGGG + Intronic
1181065817 22:20305476-20305498 TTCTGAGGTGAGGCAGGAAAAGG - Intergenic
1182298678 22:29326194-29326216 CTCAGAGGTGAGGGAGGGACAGG + Intergenic
1183521267 22:38297436-38297458 CACAGAGGTCAGGCAGAGAATGG - Intronic
1183522464 22:38303372-38303394 CTCTTGGGGGAGGCTGGGAAGGG + Intronic
1183729383 22:39609193-39609215 CTCACAGATGAGGCAGTGACAGG + Intronic
1185371315 22:50462189-50462211 CCAACAGGTGAGGCAGGGACTGG - Exonic
949517765 3:4822459-4822481 TTCAAAGTTGAGGCAGGGCATGG + Intronic
951476960 3:23117463-23117485 CACAAAGGTGAGGCAGAAAAGGG - Intergenic
952090815 3:29883251-29883273 GTCATAGCTGAGGAATGGAAAGG + Intronic
952209289 3:31213123-31213145 CTCATACCTGAGGCAGGAACAGG - Intergenic
952234684 3:31466796-31466818 CCCATAGGTGAGGCCTGGGAGGG - Intergenic
952815008 3:37439714-37439736 CTCATGTGTGAGGCTGGGAAAGG + Intergenic
953183427 3:40617185-40617207 CTGAGAGGTGAGTCAGGAAAAGG + Intergenic
954124382 3:48520147-48520169 CTCATCTGTGGGGCAGGGAAGGG + Intronic
956410097 3:68970309-68970331 ACCTAAGGTGAGGCAGGGAAAGG - Intergenic
957761632 3:84566369-84566391 CTCATAGTAGAGGTTGGGAAAGG - Intergenic
957922797 3:86768380-86768402 CCCATAAGTGATGCTGGGAAAGG + Intergenic
959971752 3:112417345-112417367 CTCATAAGTGAGCCATGAAAGGG + Intergenic
962922287 3:139961131-139961153 CACATAGGGAAGTCAGGGAAAGG + Intronic
962968337 3:140374995-140375017 CTCCTAGGTGAGCAAAGGAAGGG - Intronic
963876823 3:150485192-150485214 CTCAAATCTGAGGCAGGAAATGG + Intergenic
966377073 3:179307201-179307223 CTGACAGCTGAGTCAGGGAAGGG + Intergenic
967884338 3:194322904-194322926 CTCCTGGGTGGGGCAGGGCAAGG + Intergenic
971630422 4:28985905-28985927 CTACTAAGTGATGCAGGGAAGGG + Intergenic
971661129 4:29417564-29417586 CTCACCAGTGAGGCAAGGAAGGG + Intergenic
972269183 4:37493502-37493524 CTCAGTGGAGTGGCAGGGAAAGG - Intronic
972812853 4:42609488-42609510 CTGATGGGTGAGGCAGTGGAGGG - Intronic
973374677 4:49278541-49278563 CGCAAAGGAGAAGCAGGGAATGG + Intergenic
973382734 4:49331700-49331722 CGCAAAGGAGAAGCAGGGAATGG - Intergenic
973756430 4:54078803-54078825 ATCATAAGAGAGGCCGGGAACGG - Intronic
977528078 4:98167977-98167999 CTCCTTGGTGTGGCAGGGAGAGG + Intergenic
978373237 4:108050305-108050327 CCCTTAGGTAAGGCAGTGAAGGG + Intronic
978373343 4:108050952-108050974 CCCTTAGGTAAGGCAGTGAAGGG - Intronic
981153725 4:141409357-141409379 CTCATCTGTGAGGCAAGCAAAGG + Intergenic
983513714 4:168635391-168635413 CACATAGGAGAGGCAGGAGATGG - Intronic
985867690 5:2528106-2528128 ACCAGAGGTGAGGGAGGGAAGGG + Intergenic
985919609 5:2959675-2959697 CACACAGTTGAGGAAGGGAAAGG - Intergenic
985974042 5:3401316-3401338 CTCTGAGGAGAGGCAGGCAAAGG + Intergenic
991124685 5:63055805-63055827 CTCAAAGGTTAGGCAGAAAAGGG - Intergenic
991266184 5:64720929-64720951 ATCATAGGCGAGGCAGGAAGTGG - Exonic
991944679 5:71888674-71888696 GTCATAAGTGAGGCAGAGAGTGG + Intergenic
992354131 5:75963091-75963113 CAAAAAGGTGAGGCACGGAATGG + Intergenic
992557471 5:77917374-77917396 CTCTGGGGTGAGGCAGGGGAGGG + Intergenic
992636202 5:78727982-78728004 CTCATTGGTGAACCAGGTAATGG + Intronic
993754008 5:91704765-91704787 ATCAGAGAAGAGGCAGGGAAAGG + Intergenic
994204268 5:97015994-97016016 TTCATAGGAGACGCAGGGTAAGG - Intronic
995114258 5:108461258-108461280 CTTTTAGATGTGGCAGGGAAGGG + Intergenic
995445457 5:112237767-112237789 CCCAGAGGTTAGGCAGGGATGGG - Intronic
997675573 5:135710255-135710277 CTCATAGCTGATGCAGGAAATGG + Intergenic
997825939 5:137106870-137106892 GTCACATGTGAGGTAGGGAAAGG - Intronic
998162266 5:139820259-139820281 CTCATAGGTAAGACAGGCTACGG + Intronic
998648494 5:144090962-144090984 CTAATAAGTCAGCCAGGGAATGG + Intergenic
999190410 5:149742911-149742933 CCCACAGCTGAGGCAGGGTATGG - Intronic
999422204 5:151454655-151454677 CTCAAAGGTCAGGCAGGGCTAGG - Intronic
999505280 5:152188226-152188248 TTCATAGAGGAGGCAGGAAAGGG + Intergenic
1000630790 5:163588077-163588099 CTCAGAGGAGGGGCGGGGAAGGG + Intergenic
1000959615 5:167584505-167584527 TTCATCTGTGAGGCATGGAAAGG + Intronic
1000986043 5:167861559-167861581 TTCATAGGTCAGCCTGGGAAAGG - Intronic
1001455932 5:171859620-171859642 CTCAGAGGGGAGGAAGGGACAGG - Intergenic
1003369804 6:5513199-5513221 GTGACAGGTGAGGGAGGGAATGG + Intronic
1003514962 6:6810241-6810263 CTCATAGGGAAGGAAGGGCAGGG + Intergenic
1005154709 6:22791353-22791375 GTGATAGGAGAGGCAGGGACTGG + Intergenic
1006395232 6:33782812-33782834 CTAACAGGAGAGGCATGGAAGGG + Intronic
1006782894 6:36644062-36644084 CTCATTGGTGGGGCAGGGGATGG + Intergenic
1006811692 6:36824389-36824411 CTTACAGGGGAAGCAGGGAAGGG - Intronic
1007505846 6:42334754-42334776 CACAAAGGTGAAACAGGGAAGGG + Intronic
1009868006 6:69421182-69421204 TTCAGAGGTGGGTCAGGGAAGGG - Intergenic
1010274782 6:73956751-73956773 TTCACAGGTAAGGAAGGGAAAGG - Intergenic
1012333756 6:98027864-98027886 CTCAAAGGTGAGGCAGGATTTGG + Intergenic
1012602626 6:101116534-101116556 CTAGTGGCTGAGGCAGGGAAAGG + Intergenic
1014427920 6:121331508-121331530 CTTATAGGGGAGGCTGGGCATGG - Intronic
1014607709 6:123498527-123498549 CCCACAGGAGAGGTAGGGAATGG + Intronic
1015516591 6:134088271-134088293 AGGATTGGTGAGGCAGGGAAGGG + Intergenic
1016861239 6:148720897-148720919 CTTATAGGAAAGGCAGGGGAGGG - Intergenic
1017760496 6:157564215-157564237 CTCATAGTTGGGGCAGGGCGGGG + Intronic
1018028392 6:159822991-159823013 CTCAGAGGAGGGGCAGGGATCGG - Intergenic
1019768710 7:2870157-2870179 CTCAGAGGCGAGGCGGGGATCGG + Intergenic
1020277173 7:6631801-6631823 ACCATAGGTGAGGCTGGGAGCGG - Intergenic
1021055330 7:16040567-16040589 CTGATAGATGAGTCAGGGAGAGG - Intergenic
1022797190 7:33741638-33741660 CCCATAGGAGAGGCAAGGAATGG - Intergenic
1023929704 7:44697795-44697817 GTCCTAGGTCTGGCAGGGAAGGG - Intronic
1024888828 7:54178525-54178547 GTCATGGGTGAGCCAGGGATTGG + Intergenic
1024933852 7:54691718-54691740 CTCATAGGTGAGCCCGGGCATGG + Intergenic
1026873659 7:73867956-73867978 CTCTTTGCTGAGGCAGGGACTGG + Intergenic
1026876270 7:73880762-73880784 CCCATCGGAGAGGAAGGGAAGGG + Intergenic
1026901435 7:74039588-74039610 CTGAGAGCTGAGGCAGGGCAGGG - Intronic
1029472640 7:100764212-100764234 CTCAGAGGAGAGGCCGGGCACGG + Intronic
1031323267 7:120360238-120360260 CTTATAGGTTTTGCAGGGAAAGG + Intronic
1032491163 7:132325639-132325661 CACAAAGGAGAGGCAAGGAAGGG + Intronic
1034442370 7:151092484-151092506 CGCAGAGTTGAGGTAGGGAAGGG + Intronic
1036618163 8:10404538-10404560 ATCGTAGGTGAGGGAGGGAGCGG - Intronic
1036728625 8:11242402-11242424 CTCATGGGTCAGGAAGGAAAGGG - Intergenic
1037940715 8:22948930-22948952 CTCAGAGGTGAGGTGGGGAGAGG - Intronic
1038023764 8:23571476-23571498 CTCATAGGTGATGAAGTGGATGG - Exonic
1040922680 8:52640951-52640973 CTCAAAGGTCAGGCAGATAATGG + Intronic
1042913511 8:73851139-73851161 ATCATAGGTGACGCTGGGCATGG - Intronic
1043470046 8:80553294-80553316 CACATAGATGAGGCCGGGCATGG + Intergenic
1045949993 8:107840721-107840743 CACATAGTGGAGGGAGGGAAGGG - Intergenic
1046766305 8:118073995-118074017 CTGAAAGGTGAGGCTGGGAGAGG - Intronic
1047440362 8:124872228-124872250 ATCACAGGTGTGGCAAGGAATGG - Intergenic
1048864580 8:138750291-138750313 AGGCTAGGTGAGGCAGGGAAAGG - Intronic
1049693541 8:143973046-143973068 CCCAGAGGTGGGGCAGGGGATGG + Intronic
1050405330 9:5303649-5303671 TTCATTTGTGAGGCAGGGGATGG - Intronic
1050408632 9:5338815-5338837 TTCATTTGTGAGGCAGGGGATGG - Intronic
1051502580 9:17794044-17794066 ATCAGAGGTGAGGCATGGGAAGG - Intronic
1053150337 9:35739122-35739144 CACAGAAGGGAGGCAGGGAATGG + Intronic
1053338856 9:37304361-37304383 CTCAAGGGTGAGGCTGGGCACGG + Intronic
1054866940 9:70012657-70012679 CTCAGGGGTCAGGCAGGGAGTGG + Intergenic
1055231771 9:74074846-74074868 CACATAGGTGGGGCAGCGATGGG + Intergenic
1056834505 9:89943619-89943641 CCCAAAGGTGGGGCAGGGAGGGG - Intergenic
1056975295 9:91247334-91247356 CTGAGGGGCGAGGCAGGGAAGGG - Intronic
1059067159 9:111097415-111097437 CTGATGGGTGAAGAAGGGAAAGG - Intergenic
1059501302 9:114756505-114756527 CTCAGAGGAGAGGAAGAGAAAGG - Intergenic
1059655956 9:116357737-116357759 TTTATAGGTGAGTCAGGGAGTGG + Intronic
1061679773 9:132237279-132237301 CTCAGATGTGAGGGAGGGAGAGG - Intronic
1062030504 9:134359938-134359960 TTCCTAGGTGGGGCAAGGAAAGG - Intronic
1062274649 9:135725020-135725042 CTCCTGGGTGGGGCAGGGACAGG - Intronic
1062331613 9:136047377-136047399 CCCATAAGTGGGGCAGAGAAAGG - Intronic
1062617603 9:137405054-137405076 CTCACAGGTGAGCCAGGGGCTGG + Intronic
1186799492 X:13078897-13078919 CTGAGAGGAGAGGGAGGGAAAGG - Intergenic
1190498015 X:51045700-51045722 ATCAATGGGGAGGCAGGGAAGGG + Intergenic
1191662399 X:63665215-63665237 CTCCTTTGTGAGGCTGGGAAGGG - Intronic
1192333505 X:70199340-70199362 ATCATAGGTGAGCCAGGCTAAGG - Exonic
1195202800 X:102566057-102566079 GTCAGAGGTGAGGCATGAAATGG - Intergenic
1197431624 X:126373999-126374021 CTCAGAGGGGAGGGTGGGAAGGG + Intergenic
1199783334 X:151082796-151082818 CACATAGCTGAGACTGGGAAAGG - Intergenic