ID: 1152456842

View in Genome Browser
Species Human (GRCh38)
Location 17:80421687-80421709
Sequence TCATAGGTGAGGCAGGGAAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 377
Summary {0: 1, 1: 0, 2: 1, 3: 34, 4: 341}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152456834_1152456842 -9 Left 1152456834 17:80421673-80421695 CCAAACCCATCATCTCATAGGTG 0: 1
1: 0
2: 0
3: 13
4: 142
Right 1152456842 17:80421687-80421709 TCATAGGTGAGGCAGGGAAGGGG 0: 1
1: 0
2: 1
3: 34
4: 341
1152456831_1152456842 25 Left 1152456831 17:80421639-80421661 CCAATTTGCAGGGTACATCTTCT 0: 1
1: 0
2: 0
3: 13
4: 220
Right 1152456842 17:80421687-80421709 TCATAGGTGAGGCAGGGAAGGGG 0: 1
1: 0
2: 1
3: 34
4: 341
1152456832_1152456842 -2 Left 1152456832 17:80421666-80421688 CCTTCTTCCAAACCCATCATCTC 0: 1
1: 0
2: 4
3: 31
4: 417
Right 1152456842 17:80421687-80421709 TCATAGGTGAGGCAGGGAAGGGG 0: 1
1: 0
2: 1
3: 34
4: 341
1152456830_1152456842 28 Left 1152456830 17:80421636-80421658 CCACCAATTTGCAGGGTACATCT 0: 1
1: 0
2: 1
3: 8
4: 94
Right 1152456842 17:80421687-80421709 TCATAGGTGAGGCAGGGAAGGGG 0: 1
1: 0
2: 1
3: 34
4: 341

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152456842 Original CRISPR TCATAGGTGAGGCAGGGAAG GGG Intronic
900073740 1:795001-795023 TCTAAAGTGAGGCAGGGAAAAGG - Intergenic
900386651 1:2413748-2413770 CCAGAGGTGAGGCAAGGAACTGG - Intronic
900613378 1:3553736-3553758 CCAGAGGAGAGGCAGGGCAGCGG + Intronic
901016477 1:6234793-6234815 TCACAGATGAGACAGGGATGAGG + Intronic
901991444 1:13117493-13117515 CCTGATGTGAGGCAGGGAAGGGG + Intergenic
903433984 1:23332354-23332376 TGATAGGTGAGGCAAGGGAGAGG + Intronic
903654666 1:24942013-24942035 TCAGAGGTGAGGCAGTGAGAGGG - Intronic
904009164 1:27380198-27380220 GCAGGGGTGAGGCAGGGCAGGGG + Intronic
904490826 1:30858060-30858082 TCATAGCTGAGGGAGGGGACAGG - Intergenic
905391451 1:37638443-37638465 AGAGAGGTGAGGCGGGGAAGAGG + Intergenic
905881843 1:41468922-41468944 GCAGGGGTTAGGCAGGGAAGAGG - Intergenic
907692516 1:56683662-56683684 TCATATGTTAGACAGTGAAGAGG + Intronic
907978615 1:59458528-59458550 TCATGTGTGAGGCAGGAAAGAGG - Intronic
910273889 1:85427859-85427881 TCACAGGTGAGGGAGGGGATAGG + Intronic
911296049 1:96116282-96116304 TCATAGCTGAGGCAGAGAGAGGG - Intergenic
912309866 1:108609435-108609457 TACAAGGTAAGGCAGGGAAGAGG + Intronic
912759387 1:112353602-112353624 ACAAAAGTGAGGCAGGGAAGGGG - Intergenic
912787565 1:112619292-112619314 TCTTTCGTGGGGCAGGGAAGGGG + Exonic
912863688 1:113237556-113237578 TCATACCTAAGGCTGGGAAGAGG - Intergenic
913500586 1:119469305-119469327 GAATGGGGGAGGCAGGGAAGAGG - Intergenic
913515645 1:119603433-119603455 CTATGGGGGAGGCAGGGAAGAGG - Intergenic
913628327 1:120683149-120683171 TCAGAGGTGAGGCAGGCAGATGG + Intergenic
917041241 1:170808473-170808495 TCAGAGGAGAGACAGGGAGGAGG + Intergenic
919733971 1:200933140-200933162 TCATAAGTGAGTTAGAGAAGTGG - Intergenic
919753722 1:201053776-201053798 TCAGCTGGGAGGCAGGGAAGAGG + Intronic
919785434 1:201255219-201255241 TCATCCGTGAGGGAAGGAAGCGG - Intergenic
920051559 1:203167647-203167669 TCATGGCTGGGGCAGGGAGGTGG - Intergenic
920211751 1:204333410-204333432 TCTTAGGAGAGGCAGAGAACTGG - Intronic
920216549 1:204365150-204365172 TGGGAGGTGAGGCTGGGAAGGGG + Intronic
920979768 1:210822227-210822249 TTAGAGGTATGGCAGGGAAGTGG + Intronic
921177641 1:212608274-212608296 GACTAGGTGAGGCTGGGAAGCGG - Intronic
921343337 1:214156165-214156187 TCATGGGGGAGGCTGGGGAGGGG - Intergenic
921482290 1:215677048-215677070 TCAACGGTGAGGGAGGGAAGAGG - Intronic
923658739 1:235940574-235940596 CCATAAGTAGGGCAGGGAAGTGG - Intergenic
1063045889 10:2392356-2392378 TGACAGGTGAGGAAGGGGAGGGG + Intergenic
1063572300 10:7227392-7227414 TCACAGGTGAGGCCAGTAAGTGG - Intronic
1063972292 10:11389530-11389552 TCCTGAGTGAGGCAGGGATGTGG - Intergenic
1065534818 10:26706727-26706749 TCAGAGGAGAGGCTGGAAAGGGG - Intronic
1066401388 10:35080110-35080132 GAATAAGGGAGGCAGGGAAGTGG + Intronic
1068611489 10:59065231-59065253 TATTAGATGTGGCAGGGAAGAGG - Intergenic
1069638213 10:69938334-69938356 ACACAGGTGAGGCAGTGAAGAGG - Intronic
1069789503 10:71010690-71010712 CCATGGGAGAGACAGGGAAGGGG + Intergenic
1070415738 10:76187682-76187704 ACAGAGGTAAGGAAGGGAAGTGG + Intronic
1070941382 10:80351270-80351292 TCATAGGTTGGGCAGGGAGAAGG - Intronic
1073176317 10:101559686-101559708 GAGTAGGTGAGACAGGGAAGGGG - Intergenic
1073209166 10:101784372-101784394 TTGTAGGTGAGGCATGAAAGAGG + Intergenic
1073484057 10:103805511-103805533 TCCTAGGCTAGGCTGGGAAGTGG - Intronic
1073689084 10:105787400-105787422 TCATAGGTAAGGCAGGTCACAGG + Intergenic
1076551878 10:131285018-131285040 TCATAGAAGAAGCTGGGAAGTGG - Intronic
1076674870 10:132142552-132142574 GCTAAGGTGAGCCAGGGAAGTGG - Intronic
1077009446 11:373683-373705 AAATAGTGGAGGCAGGGAAGGGG - Intronic
1077532913 11:3105689-3105711 ACAGAGGTGGGGCAGGGAGGTGG - Intronic
1078427381 11:11262890-11262912 TTATAGATGAGGAAAGGAAGAGG - Intergenic
1080383876 11:31799167-31799189 TCAAAAGTCAGGCAGGGATGGGG + Intronic
1080843693 11:36007511-36007533 ATAAAGGTGAGGGAGGGAAGAGG + Intronic
1081071439 11:38615172-38615194 TCATGGATGAGGAAAGGAAGTGG - Intergenic
1083325772 11:61872250-61872272 TCACAGGCTGGGCAGGGAAGGGG + Intergenic
1083421614 11:62556470-62556492 GCAGATGTGAGGCAGGAAAGGGG - Intergenic
1083676377 11:64327861-64327883 TGACAGGAAAGGCAGGGAAGTGG - Intergenic
1084269126 11:68019791-68019813 TCACAGGTGAGGCCGGGACGAGG + Exonic
1084601546 11:70148804-70148826 TTGTATGTGAGGCAGGGATGGGG - Intronic
1084774689 11:71367740-71367762 GCATTGGTGGAGCAGGGAAGAGG - Intergenic
1085201405 11:74704443-74704465 CAATCTGTGAGGCAGGGAAGGGG - Intronic
1085642788 11:78203294-78203316 TCGGAGGGGAGGCATGGAAGTGG + Intronic
1085706663 11:78792535-78792557 GCACGGGTGAGGCAGGGAAGAGG - Intronic
1086411865 11:86551872-86551894 AGAAAGGTGAGGCTGGGAAGTGG - Intronic
1088461118 11:110084056-110084078 TTATAGGAGAGGCAGAGTAGTGG - Intergenic
1089461851 11:118658440-118658462 TCCTGGGAGAGGCAGGGCAGTGG + Exonic
1089466225 11:118688184-118688206 TCCTGGGAGAGGCAGGGCAGTGG + Intergenic
1089560547 11:119341052-119341074 CCAGAGGAGAGGCAGGGCAGTGG + Exonic
1090273998 11:125407042-125407064 TTTTAGGTGGGGCAGGGAAGAGG - Intronic
1090528649 11:127565109-127565131 TCAAAGGTGTGGCTGGGATGAGG + Intergenic
1090702891 11:129312284-129312306 TCATAGGTTGGGAGGGGAAGTGG - Intergenic
1091004018 11:131935594-131935616 GGATAGGTGGGGGAGGGAAGGGG + Intronic
1092077103 12:5683043-5683065 TCAAGGGTGTGGCAGAGAAGAGG - Intronic
1093338257 12:17936776-17936798 TCATAGGTGTTTCAGGTAAGGGG + Intergenic
1095092702 12:38121677-38121699 TCCTCTGTGATGCAGGGAAGTGG - Intergenic
1096503102 12:52077287-52077309 TCATTGGTGAGACTTGGAAGGGG + Exonic
1096602651 12:52741460-52741482 TCAGAGCTGAAGCAGGGAATGGG + Intergenic
1096804642 12:54133096-54133118 TCAGAGGTGAGGGAGGGTAGGGG + Intergenic
1097040947 12:56155587-56155609 CCCTTGGTGAGGCAGGCAAGGGG + Exonic
1097391866 12:59024984-59025006 TCATAGGTGAGGGTGAGAACTGG + Intergenic
1097706240 12:62871373-62871395 GCATAGGGGAGGCAGAGAATGGG + Intronic
1101143325 12:101818314-101818336 TCATAGTCCAGGCAGGGAGGTGG - Intronic
1101266402 12:103092918-103092940 TCAGAAGTGAAACAGGGAAGAGG - Intergenic
1103966666 12:124644478-124644500 TCTAAGGAGAGGCAGGGAAGGGG + Intergenic
1104153936 12:126112037-126112059 TTATAGGTCAGGCTGGGAGGTGG + Intergenic
1105980853 13:25514874-25514896 TCATATATTAGGCAGGGCAGAGG - Intronic
1106373596 13:29161839-29161861 TCAGAGGTGAGGCAGAGAGTGGG - Intronic
1107427759 13:40311305-40311327 TTAAAGGTGAGGCAGAGAAGGGG + Intergenic
1109852094 13:68078612-68078634 TCATAGGTGAGACAGAAGAGAGG + Intergenic
1112740740 13:102470517-102470539 TCCTGGGTGAGGCAGTGAAGTGG - Intergenic
1114173935 14:20302060-20302082 TCATAGGTGAGAAAGAGAATTGG - Intronic
1114215611 14:20655667-20655689 TCAGAGGTGAGCCAGTGAATGGG - Intergenic
1116074946 14:40099835-40099857 TCATTGGTGGGGCAGGGGATGGG + Intergenic
1117628721 14:57667188-57667210 GCATGGGGGAGGGAGGGAAGGGG + Intronic
1118331369 14:64818382-64818404 GCATGGGTAAGGCAGGGGAGTGG + Intronic
1118547748 14:66912362-66912384 TCTTAGGTAAGGAAGGGTAGGGG - Intronic
1118594220 14:67423499-67423521 CCACAGGTGAGGGAGGGGAGGGG + Intergenic
1119169004 14:72518582-72518604 TAATAGGTCAGGCAATGAAGGGG - Intronic
1122053320 14:99074920-99074942 TCAGAGGTGAGGGAGGTAAAGGG - Intergenic
1122083036 14:99280102-99280124 TCATAGGTCGGGCAGGGCACTGG - Intergenic
1122143698 14:99676672-99676694 TCAGAGAGGAGGCAGGAAAGTGG - Exonic
1125801989 15:42457456-42457478 TGAAAGGGGAGGCAGGGCAGGGG + Exonic
1128460927 15:67866344-67866366 TAATAGGTGAGCCTGAGAAGGGG + Intergenic
1128684814 15:69675925-69675947 TGATATGTGAGGCAGGGACAAGG - Intergenic
1128839145 15:70835494-70835516 CAGTGGGTGAGGCAGGGAAGAGG + Intronic
1129709145 15:77811425-77811447 ACACAGGAGAGGCAGGGGAGGGG - Intronic
1130044673 15:80434728-80434750 GCAGAGGAGAGGCAGGGAACGGG + Intronic
1130984080 15:88833410-88833432 GCATAGGTGAGGCAGAGGAAGGG - Intronic
1131045977 15:89315855-89315877 TCAAAGGTGGTGCAGGGATGGGG - Intronic
1132270249 15:100517817-100517839 TTACAGGAGAGGCAGGGAAATGG + Intronic
1132515547 16:364188-364210 GCATAGGGAGGGCAGGGAAGGGG + Intergenic
1132634779 16:938364-938386 TCACAGGGAAGGCAGGGATGGGG + Intronic
1132897143 16:2234460-2234482 GCATGGTGGAGGCAGGGAAGGGG - Intronic
1133613313 16:7453350-7453372 TCATAGTTGAGCTAGGGAGGTGG + Intronic
1133878262 16:9755967-9755989 TCAGAGGTGGGACAGGGAATAGG - Intronic
1133908096 16:10039720-10039742 TCATTGCTGAGGGAGGGAGGGGG - Intronic
1134861949 16:17568212-17568234 TCATGGATGAGGCAAGGAAGAGG - Intergenic
1135955472 16:26953118-26953140 TGGTGGGTGAGGCAGGGAGGCGG - Intergenic
1137715449 16:50595587-50595609 TCATAGGGGAGGCAAGAGAGTGG - Intronic
1137877932 16:52014976-52014998 TTATAGGTGAGGCAGAGAACTGG - Intronic
1138624196 16:58236365-58236387 TTCTAGGTGAGACGGGGAAGGGG + Intronic
1138909146 16:61375322-61375344 TCATAGGTGAGGGAGGGGTGGGG + Intergenic
1139545061 16:67646174-67646196 TCAAAGGTGACCTAGGGAAGGGG - Exonic
1139588418 16:67919166-67919188 GCAGAGTGGAGGCAGGGAAGCGG + Intronic
1140712873 16:77694645-77694667 TCATAGGTAAGGCAGTGATGAGG - Intergenic
1140939503 16:79708186-79708208 ACACAGGTGGGGCTGGGAAGAGG - Intergenic
1140973639 16:80038202-80038224 TCAGAGGTGAGCCTGGGCAGAGG - Intergenic
1141083229 16:81071984-81072006 TCCTGGGTGAGGCAGTGAATAGG + Intronic
1141085242 16:81089673-81089695 TATTGGGTGAGGCGGGGAAGGGG - Intronic
1141100921 16:81196982-81197004 TCCTCGATGAGGCAGGGCAGGGG - Intergenic
1141245472 16:82302914-82302936 TCAGGGATGAGGCAGGGAGGAGG - Intergenic
1142078571 16:88135036-88135058 TCATCGGTGAGGCAGGCACATGG - Intergenic
1142294260 16:89210001-89210023 TACAGGGTGAGGCAGGGAAGGGG - Intergenic
1142484223 17:236365-236387 GCAGAGCTGAGGCAGGGCAGGGG - Intronic
1145004326 17:19328905-19328927 TCAGAGGCCAGGCAGGAAAGTGG - Intronic
1145790891 17:27625855-27625877 TCAGAGGTGAGGCTGGAAACTGG - Exonic
1146001348 17:29132414-29132436 TCCTAGGTGACGCGGGAAAGAGG - Intronic
1146472149 17:33133215-33133237 CCAAAGGTGGGGAAGGGAAGAGG + Intronic
1146675138 17:34768080-34768102 TGAGAGGTGAGGGAGGGAGGTGG + Intergenic
1146913794 17:36665265-36665287 ACAGAGGTGGGGAAGGGAAGGGG - Intergenic
1147343147 17:39767383-39767405 TCACAGGGAAGGCAGGGATGGGG + Intronic
1148506019 17:48127750-48127772 TGTTACGGGAGGCAGGGAAGTGG + Intergenic
1149334020 17:55616919-55616941 TCATGGTTGAGGCAGGAATGGGG - Intergenic
1149596208 17:57866314-57866336 TCATAGTTGCGGCAGGGACACGG - Intronic
1149856019 17:60083603-60083625 GGATATGGGAGGCAGGGAAGAGG - Intergenic
1150300828 17:64045611-64045633 TCATGGATGAGGGAGGGAGGGGG - Intronic
1151733306 17:75923484-75923506 TGGTGGGTGAGGCAGGGAACAGG + Exonic
1151796251 17:76347893-76347915 TCAAAGATGAGGCAGGTAAAGGG + Intronic
1152252486 17:79219184-79219206 CCAGAGGTCAGGCTGGGAAGGGG + Intronic
1152456842 17:80421687-80421709 TCATAGGTGAGGCAGGGAAGGGG + Intronic
1153572434 18:6486633-6486655 TGAGAGATGAGGCTGGGAAGAGG + Intergenic
1153625188 18:7016543-7016565 TCCCAGGTGTGGCAGGGAAAAGG - Exonic
1154148261 18:11884726-11884748 CCTCAGGTGAGGCAGGGAACGGG + Exonic
1154312184 18:13275899-13275921 TGGTAGATGAGGCAGGGCAGAGG + Intronic
1155244457 18:23894063-23894085 GCATGGGTGAGGGAGGGAAAAGG + Intronic
1157444611 18:47735286-47735308 TCATAGGTGAGGTGGGGAGTGGG - Intergenic
1157684461 18:49631221-49631243 TCCTAGGTGAGTCAGGGGTGAGG - Intergenic
1157746660 18:50141853-50141875 AGAGAGGTGAGGCAGGGAATGGG - Intronic
1157980708 18:52376857-52376879 TAAAAGTTGAGGAAGGGAAGGGG + Intronic
1159383729 18:67695398-67695420 TAATAGGTTGGGAAGGGAAGTGG + Intergenic
1160029996 18:75249862-75249884 GCAGGGGTGAGGCAGGGAGGAGG - Intronic
1160680055 19:408358-408380 TCATGGGGGCGGCAGGCAAGAGG + Exonic
1161465963 19:4430636-4430658 ACAGAGGTGAGGGAGTGAAGGGG + Exonic
1161759601 19:6161449-6161471 TGAAAGGTGAGGAAAGGAAGTGG + Intronic
1161814944 19:6494344-6494366 TTGAGGGTGAGGCAGGGAAGCGG + Exonic
1163128300 19:15256383-15256405 GCATAGGGGAGGCAGGGGAAGGG + Intronic
1163551953 19:17970218-17970240 TGATGGGTGAGGGTGGGAAGGGG + Intronic
1163840081 19:19602297-19602319 TCATAGGTGACTCAGCGGAGAGG + Intronic
1163862769 19:19750761-19750783 GCACAGATGAGGCTGGGAAGAGG - Intergenic
1165166427 19:33860449-33860471 TCCAAGGGAAGGCAGGGAAGTGG - Intergenic
1165255760 19:34576582-34576604 TGACGGTTGAGGCAGGGAAGGGG + Intergenic
1165273731 19:34731813-34731835 TCAAGGCTGAGCCAGGGAAGCGG - Intergenic
1165356524 19:35307850-35307872 TCATGGGTGAGGAAGGGCCGGGG + Intronic
1165636440 19:37344179-37344201 TCATAGGGGAGGGAGGAGAGAGG + Intronic
1165769393 19:38370059-38370081 CAATAGGTGAGCCAGGCAAGTGG + Exonic
1166798555 19:45442635-45442657 TCAAAGTTGAGGCAAGGAAGTGG + Intronic
1167589312 19:50394748-50394770 TCCTAGATGCGGCTGGGAAGAGG - Intronic
925894726 2:8462660-8462682 TCAAAAGTCAGGCAGGGAGGAGG + Intergenic
926197743 2:10773920-10773942 TTACAGGGGAGGCAGGGAAGAGG + Intronic
926538658 2:14146662-14146684 TCTTTAGGGAGGCAGGGAAGAGG + Intergenic
927099147 2:19774597-19774619 TCATAGGTCAGGCAGGGTGAAGG + Intergenic
928123221 2:28598887-28598909 TCACAGGGGCAGCAGGGAAGAGG - Intronic
928289781 2:30026986-30027008 TCAAAGGTTAGGCATGGAGGAGG - Intergenic
929146178 2:38708786-38708808 TCCTCTGTGAGGCAGGGAAGTGG + Intronic
929683554 2:44015238-44015260 TCATGGAGGAGGCAGGGTAGGGG + Intergenic
930261818 2:49155487-49155509 TCCTTGGTAAGGCAGGGGAGAGG - Intergenic
934735076 2:96685944-96685966 TGATAGGTCATGCAGGGCAGAGG - Intergenic
935329057 2:101963050-101963072 TCAAGGGTGAGGCAGGGACAGGG - Intergenic
935330501 2:101974107-101974129 TCATAGGGGAGGGAGTGATGGGG + Intergenic
935331578 2:101981222-101981244 TCCCAGGTGAGGCAGGTGAGAGG - Intergenic
935404788 2:102697660-102697682 TCACAGGTAGAGCAGGGAAGTGG + Intronic
936161538 2:110087198-110087220 TGAGAGATGAAGCAGGGAAGGGG - Intronic
936183125 2:110284156-110284178 TGAGAGATGAAGCAGGGAAGGGG + Intergenic
936476222 2:112842406-112842428 TTCTAGTTGAGACAGGGAAGTGG - Intergenic
936487520 2:112939018-112939040 TCATAGGTAAGTCTGGGAGGAGG + Intergenic
936925587 2:117733398-117733420 TCAGAGGTTAGGAAGGGTAGTGG + Intergenic
939969278 2:148642382-148642404 CCATATGTGAGGCATGGAACTGG + Intergenic
940867003 2:158827040-158827062 TTATAGGTGAGGAAGTGAATTGG - Intronic
940884016 2:158973277-158973299 GCTGAGGTGGGGCAGGGAAGAGG - Intronic
941237420 2:162992531-162992553 GGATAAGTGAGACAGGGAAGAGG + Intergenic
941749160 2:169117284-169117306 TGATAAGTGAGGAAAGGAAGGGG + Intergenic
943065883 2:183085611-183085633 CCATAGGTGAGGAGGGGGAGGGG + Intronic
943840551 2:192574613-192574635 GGAGAGGGGAGGCAGGGAAGGGG + Intergenic
945032553 2:205679600-205679622 TCCTAGGTGAGTCAGTGATGTGG + Intergenic
945253367 2:207783362-207783384 GCAGAGGTGAGGAAGGGATGAGG + Intergenic
946100077 2:217312929-217312951 ACCTAGGACAGGCAGGGAAGGGG + Intronic
946243381 2:218370682-218370704 TCACAGAGGAGACAGGGAAGTGG - Intergenic
946419903 2:219558816-219558838 TCAGAGGCAAGGCAGGGAAAGGG - Intronic
947174965 2:227356594-227356616 TCATAGGAGAGGCATAGAAAGGG + Intronic
947181306 2:227413749-227413771 TCATAGGTGACCCTGGGGAGAGG + Intergenic
948003737 2:234590382-234590404 TGTTAGGTAATGCAGGGAAGGGG + Intergenic
1170359828 20:15533898-15533920 TGATGGGAGAGCCAGGGAAGTGG + Intronic
1172216780 20:33241348-33241370 TCATGGGTGATGCAGGGACCTGG - Intronic
1172379790 20:34479865-34479887 TCATATGAGAGAAAGGGAAGTGG + Intronic
1173924588 20:46771319-46771341 TCCTGGGTGAGGCTGGGATGGGG + Intergenic
1174537223 20:51260595-51260617 TCATAGGTAATCCAGGGAAGCGG - Intergenic
1176872523 21:14095257-14095279 TCCTCTGTGAGGCAGGGAAGTGG + Intergenic
1179010905 21:37555362-37555384 CCAAAGGTTAAGCAGGGAAGAGG - Intergenic
1181584694 22:23846708-23846730 AAATAGCTGAGGCAGGGGAGGGG - Intergenic
1181811641 22:25406744-25406766 TCAGACCTCAGGCAGGGAAGAGG + Intergenic
1182298679 22:29326195-29326217 TCAGAGGTGAGGGAGGGACAGGG + Intergenic
1182439465 22:30354285-30354307 CCAGATGGGAGGCAGGGAAGTGG - Intronic
1183145098 22:35982978-35983000 TTGTAGGGGAGGAAGGGAAGAGG - Intronic
1183522465 22:38303373-38303395 TCTTGGGGGAGGCTGGGAAGGGG + Intronic
1184397030 22:44248441-44248463 TCATAGGTGTCCCAGGGCAGCGG + Exonic
949098469 3:114418-114440 GCATAGGTGTTGCAGGAAAGGGG - Intergenic
950104668 3:10380482-10380504 TCATAGGTGAGGCTGTGGCGAGG - Intronic
951773758 3:26286070-26286092 TCATAGGGGAGGGAGGAGAGGGG - Intergenic
952306176 3:32148411-32148433 TCATGGGGGATGCAGGGAGGTGG + Intronic
953607262 3:44420061-44420083 TCCTAGGTGGGGCAGGTCAGAGG - Intergenic
954124383 3:48520148-48520170 TCATCTGTGGGGCAGGGAAGGGG + Intronic
954932880 3:54299249-54299271 ACATAGCAGAGGCAGGGAGGAGG + Intronic
954987696 3:54810076-54810098 GAATCAGTGAGGCAGGGAAGTGG + Intronic
955708403 3:61752921-61752943 TCCAAGGTGATGCAGTGAAGTGG - Intronic
955846742 3:63171663-63171685 TCATAAGTGAGACAAGCAAGTGG - Intergenic
956615362 3:71165814-71165836 TCATAGGTGAGGCAGGCAACAGG + Intronic
957502325 3:81073075-81073097 TCACAAGTGAGGAATGGAAGAGG + Intergenic
958428612 3:94009901-94009923 TGATAGGGAAGGCAGGGATGGGG - Intronic
959849580 3:111071432-111071454 CCATTGGAAAGGCAGGGAAGGGG + Intronic
959971753 3:112417346-112417368 TCATAAGTGAGCCATGAAAGGGG + Intergenic
961001050 3:123374230-123374252 GCACAGGTGGGGCAGTGAAGAGG + Intronic
962210578 3:133474009-133474031 CCATAGTGGAGGCAGGCAAGGGG + Intronic
964484570 3:157174646-157174668 TCAGAGGTCAAGCAGGGAGGTGG + Intergenic
965083030 3:164060187-164060209 TCATAGATGAAGGAGAGAAGGGG + Intergenic
965655304 3:170976955-170976977 TCATAGATGAGGCAGGATACAGG + Intergenic
966129969 3:176625992-176626014 TTTTAGGTGAGGGAGGTAAGTGG - Intergenic
966253204 3:177889806-177889828 GCATAGGCGATGCATGGAAGAGG + Intergenic
966377074 3:179307202-179307224 TGACAGCTGAGTCAGGGAAGGGG + Intergenic
966409203 3:179631240-179631262 TCTTAGGGGAGGAAGTGAAGTGG + Intergenic
966586116 3:181627131-181627153 ATATTTGTGAGGCAGGGAAGGGG - Intergenic
967069651 3:185951732-185951754 TCAGAGGTGAGGAAGAGATGAGG - Intergenic
969241092 4:5898228-5898250 TTGCAGGTGAGGCAGGGAAGAGG - Intronic
969409910 4:7021202-7021224 TGATACGTGAGGGAGGAAAGGGG - Intronic
969461936 4:7333597-7333619 CCCCAGGTGAGGCAGGGAGGTGG - Intronic
969512829 4:7629448-7629470 TGAGAGGTGAGGGAGGGAGGAGG + Intronic
969940262 4:10724962-10724984 TTATTTGTGAGGCAGGGAAGAGG + Intergenic
970297411 4:14645132-14645154 TCATAGGTGAGACAATGAACTGG - Intergenic
971630423 4:28985906-28985928 TACTAAGTGATGCAGGGAAGGGG + Intergenic
971661130 4:29417565-29417587 TCACCAGTGAGGCAAGGAAGGGG + Intergenic
973781204 4:54289791-54289813 TCACAGGTGAGGCAGTGAGGAGG + Intronic
976197680 4:82548929-82548951 TGATAGGTGAGCCAGAGAGGTGG + Intronic
976447348 4:85146372-85146394 TCATGGGCGATGCATGGAAGTGG + Intergenic
977409351 4:96641727-96641749 TGATATCTGAGGCAGAGAAGGGG - Intergenic
978618030 4:110614998-110615020 TAACAGGTGAGGGATGGAAGGGG + Intergenic
978696804 4:111590642-111590664 ACATATGTGAGGTGGGGAAGGGG - Intergenic
980479170 4:133364039-133364061 TCTTAGGTAAGGCACAGAAGTGG - Intergenic
982241957 4:153308840-153308862 GCAGAGGTGGGGCAGGGGAGAGG - Intronic
982406544 4:155026781-155026803 GCTTAGGGGAGGAAGGGAAGAGG - Intergenic
985766989 5:1785324-1785346 TCACAGGACAGGCAGGGGAGGGG - Intergenic
985856666 5:2433517-2433539 ACAAAGGTGAGGCAGAGAAGTGG - Intergenic
985867692 5:2528107-2528129 CCAGAGGTGAGGGAGGGAAGGGG + Intergenic
985945747 5:3181615-3181637 TCAGAGGTGGGGCAGGGTGGGGG - Intergenic
986208442 5:5647977-5647999 TCATCGGCGAGGCAGAAAAGTGG - Intergenic
986287055 5:6367103-6367125 GCACAGGTGAGCCAGGAAAGAGG + Intergenic
986415717 5:7526059-7526081 TCAGAGCTGGGACAGGGAAGAGG - Intronic
986575491 5:9208562-9208584 GCAGAGGTGAGGCTGAGAAGGGG + Intronic
989115533 5:37948928-37948950 TGGGAAGTGAGGCAGGGAAGAGG + Intergenic
991007183 5:61840909-61840931 CCATAGGTGAGGTAGGGGAAAGG + Intergenic
991124684 5:63055804-63055826 TCAAAGGTTAGGCAGAAAAGGGG - Intergenic
992150567 5:73898363-73898385 TCAAAAATGAGGCAGGGTAGGGG - Intronic
992759228 5:79936915-79936937 TGGTGGGTGGGGCAGGGAAGGGG - Intergenic
994753590 5:103767804-103767826 TCATTTGTGAAGGAGGGAAGAGG - Intergenic
995114259 5:108461259-108461281 TTTTAGATGTGGCAGGGAAGGGG + Intergenic
997675574 5:135710256-135710278 TCATAGCTGATGCAGGAAATGGG + Intergenic
997825938 5:137106869-137106891 TCACATGTGAGGTAGGGAAAGGG - Intronic
1000178549 5:158783877-158783899 CCAGAAGAGAGGCAGGGAAGAGG + Intronic
1000959616 5:167584506-167584528 TCATCTGTGAGGCATGGAAAGGG + Intronic
1001159661 5:169301581-169301603 TACTAGGTGCGGTAGGGAAGCGG - Intergenic
1001244754 5:170097879-170097901 TCATTTGTGAGGGAGGGAAACGG - Intergenic
1005417027 6:25610812-25610834 TCAAAGGTGAGGCATGGTTGTGG + Intronic
1006316862 6:33296568-33296590 TCATAAGGGACGCAGGGTAGTGG - Intronic
1006395233 6:33782813-33782835 TAACAGGAGAGGCATGGAAGGGG + Intronic
1006401548 6:33820795-33820817 ACAAAGGGGAGGCTGGGAAGCGG - Intergenic
1006466879 6:34200889-34200911 TCACAAGGGAGGCTGGGAAGTGG + Intergenic
1006782895 6:36644063-36644085 TCATTGGTGGGGCAGGGGATGGG + Intergenic
1006946396 6:37787216-37787238 TCAGAAGAAAGGCAGGGAAGTGG + Intergenic
1007925088 6:45643913-45643935 TCCAAGGTGAGGCAGCTAAGGGG + Intronic
1008693459 6:54006918-54006940 TGGTAGGTGAGGAAGGGAGGAGG - Intronic
1009243323 6:61204653-61204675 TAATAAGTTAGGCAGGCAAGTGG + Intergenic
1009868005 6:69421181-69421203 TCAGAGGTGGGTCAGGGAAGGGG - Intergenic
1014268041 6:119303851-119303873 TCAGACTTGAGGCTGGGAAGAGG - Intronic
1014400214 6:120979478-120979500 CCATAGGTCACCCAGGGAAGTGG - Intergenic
1014846723 6:126286895-126286917 TAATAGGTGAGGGAAGAAAGAGG - Intergenic
1014995920 6:128144152-128144174 TCATGTTTGAGGAAGGGAAGAGG - Intronic
1016861238 6:148720896-148720918 TTATAGGAAAGGCAGGGGAGGGG - Intergenic
1017760497 6:157564216-157564238 TCATAGTTGGGGCAGGGCGGGGG + Intronic
1018028380 6:159822936-159822958 TCAGAGGCGGGGCAGGGAGGTGG - Intergenic
1018766947 6:166941623-166941645 TCATCGGTGTGGCAGTGAAGTGG - Intronic
1019562701 7:1666253-1666275 CCCTAGGGGAGGCAGGGAAGAGG + Intergenic
1021009647 7:15445850-15445872 GCAGAAGAGAGGCAGGGAAGAGG - Intronic
1021544753 7:21800695-21800717 TCATAGTTCAGGCAGTGAAGAGG - Intronic
1022797188 7:33741637-33741659 CCATAGGAGAGGCAAGGAATGGG - Intergenic
1025707670 7:63882424-63882446 TTAAAGGTGTGGCAGGGCAGTGG + Intergenic
1027187797 7:75982187-75982209 CCAAGGGTGAGGCCGGGAAGCGG - Intronic
1028947072 7:96592204-96592226 TCTTAGGTAAGCCCGGGAAGAGG + Intronic
1029409908 7:100402462-100402484 CCACAGTTAAGGCAGGGAAGTGG - Intronic
1031183579 7:118447260-118447282 TCATGGATGAGGAAAGGAAGTGG - Intergenic
1031360458 7:120843540-120843562 GTATAGGTGAGGCAGGTAAGTGG - Intronic
1031994222 7:128218325-128218347 TCATAGCTGGGGAAGGAAAGGGG + Intergenic
1032097535 7:128947051-128947073 TCACAGGTGGGGCCGGGAGGTGG + Exonic
1032467113 7:132153092-132153114 GCAGGGGTGAGACAGGGAAGAGG + Intronic
1032507965 7:132450283-132450305 TCATAGCTGAGGAAGAGTAGAGG - Intronic
1033134777 7:138775262-138775284 TCAGAGGTGGGGAGGGGAAGTGG - Intronic
1033473788 7:141671560-141671582 CCCTAGGAGATGCAGGGAAGAGG - Intronic
1034442371 7:151092485-151092507 GCAGAGTTGAGGTAGGGAAGGGG + Intronic
1035208023 7:157307459-157307481 TCAGAGGTGTGGCCGTGAAGCGG - Intergenic
1035541907 8:446578-446600 TCTAAAGTGAGGCAGGGAAAAGG + Intronic
1035973285 8:4277351-4277373 TCAGAGATGAGGCACGAAAGAGG - Intronic
1036181133 8:6586364-6586386 TTAAAGGTGGGGCAGGTAAGAGG - Intronic
1036728624 8:11242401-11242423 TCATGGGTCAGGAAGGAAAGGGG - Intergenic
1038701092 8:29849866-29849888 TCATAGATCAGGGTGGGAAGCGG + Intergenic
1039549516 8:38432811-38432833 TTGAAGGTGAGGCAGGGATGTGG - Intronic
1040599765 8:48871668-48871690 TCTTAGCAGAGGCGGGGAAGCGG + Intergenic
1041729547 8:61050901-61050923 TCCCAGGGGTGGCAGGGAAGAGG - Intergenic
1045949992 8:107840720-107840742 ACATAGTGGAGGGAGGGAAGGGG - Intergenic
1047383294 8:124384687-124384709 TCATGGGTGAGGGAGGGATCTGG - Intergenic
1048579054 8:135715966-135715988 CCAAGGGTGAGGCAGGGAACAGG + Intergenic
1049196459 8:141318351-141318373 TCAGAGGTGGGCCTGGGAAGTGG - Intergenic
1049245393 8:141559690-141559712 TCATAGCTGAGCCAGGGAACAGG + Intergenic
1049356992 8:142193888-142193910 ACATTGGTGAGGAAGGGACGGGG - Intergenic
1050047709 9:1564796-1564818 TCATAGGTGAGGAATCCAAGGGG + Intergenic
1050150968 9:2619236-2619258 TGGTAGGGGAGGCAGGCAAGTGG - Intergenic
1053005280 9:34600234-34600256 GCCTAGGTGAGGTAGGGTAGGGG + Intergenic
1055231772 9:74074847-74074869 ACATAGGTGGGGCAGCGATGGGG + Intergenic
1056834503 9:89943618-89943640 CCAAAGGTGGGGCAGGGAGGGGG - Intergenic
1056975294 9:91247333-91247355 TGAGGGGCGAGGCAGGGAAGGGG - Intronic
1057254940 9:93538570-93538592 TCATAGGTGAGGAAGAGATGCGG - Intronic
1057598994 9:96440805-96440827 TCCTAGGTGTGGCTGGGTAGGGG + Intergenic
1057723973 9:97555269-97555291 TAATCTGTGAGGCAGGGAGGTGG + Intronic
1059221394 9:112623773-112623795 TTATAATTCAGGCAGGGAAGTGG + Intronic
1059358420 9:113719357-113719379 CCACAGTTGAGGCAGGGGAGAGG - Intergenic
1060806871 9:126583235-126583257 GCAGAGGGGAGGCGGGGAAGCGG + Intergenic
1061199216 9:129126916-129126938 TCTTAGGCGAGGCACTGAAGGGG - Intronic
1061921787 9:133786697-133786719 CCGAAGGGGAGGCAGGGAAGGGG - Intronic
1062046278 9:134425914-134425936 TCAGAGGTGAGACAGGAACGTGG + Intronic
1185458836 X:324329-324351 TCCAACGTGAGGCAAGGAAGAGG - Intergenic
1186098610 X:6130533-6130555 TTATAGAAGAGGCAGGAAAGTGG - Intronic
1186521779 X:10212660-10212682 CCATGGGTGGGGCAGGGAGGGGG + Intronic
1186611841 X:11145486-11145508 TCAAAGAGGAGGCAAGGAAGGGG - Intronic
1187128915 X:16481980-16482002 TCATATCTGAAGCAGGGCAGTGG + Intergenic
1188075275 X:25768248-25768270 TTGTAGGGGAGGCAGAGAAGTGG + Intergenic
1189862118 X:45283412-45283434 TTACATGTGAGGCAGGGTAGGGG + Intergenic
1190498768 X:51054522-51054544 TCAGAGTTTAGGCAGGGTAGGGG + Intergenic
1190526070 X:51331190-51331212 GCATACTTGTGGCAGGGAAGAGG - Intergenic
1190543399 X:51500480-51500502 GCATACTTGTGGCAGGGAAGAGG + Intergenic
1192053219 X:67746134-67746156 TGAAAGTAGAGGCAGGGAAGAGG - Intergenic
1194337533 X:92666198-92666220 TGATAGGGGTGGCAGGGGAGTGG - Intergenic
1197248528 X:124190951-124190973 TTGTATGTGGGGCAGGGAAGAGG - Intronic
1197431625 X:126374000-126374022 TCAGAGGGGAGGGTGGGAAGGGG + Intergenic
1198529124 X:137532413-137532435 TTATAAGTGAGGCTGGGACGGGG - Intergenic
1199276200 X:145945236-145945258 GCATAAGTGAGGCAGGTGAGAGG - Intergenic
1200645952 Y:5782940-5782962 TGATAGGGGTGGCAGGGGAGTGG - Intergenic
1200767906 Y:7096074-7096096 GCACAGGTGAAGCAGGGAGGGGG + Intergenic
1201767790 Y:17588890-17588912 TCCTCTGTGAGGCTGGGAAGTGG + Intergenic
1201833763 Y:18317095-18317117 TCCTCTGTGAGGCTGGGAAGTGG - Intergenic