ID: 1152457994

View in Genome Browser
Species Human (GRCh38)
Location 17:80427004-80427026
Sequence AGGCCCCGGCCCGAAGGTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 213
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 199}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152457994_1152458006 12 Left 1152457994 17:80427004-80427026 CCACCACCTTCGGGCCGGGGCCT 0: 1
1: 0
2: 0
3: 13
4: 199
Right 1152458006 17:80427039-80427061 CGCGCAGTGTGGCCTCCAGGGGG 0: 1
1: 0
2: 2
3: 10
4: 129
1152457994_1152458004 10 Left 1152457994 17:80427004-80427026 CCACCACCTTCGGGCCGGGGCCT 0: 1
1: 0
2: 0
3: 13
4: 199
Right 1152458004 17:80427037-80427059 GGCGCGCAGTGTGGCCTCCAGGG 0: 1
1: 0
2: 0
3: 11
4: 111
1152457994_1152458005 11 Left 1152457994 17:80427004-80427026 CCACCACCTTCGGGCCGGGGCCT 0: 1
1: 0
2: 0
3: 13
4: 199
Right 1152458005 17:80427038-80427060 GCGCGCAGTGTGGCCTCCAGGGG 0: 1
1: 0
2: 0
3: 8
4: 127
1152457994_1152458002 1 Left 1152457994 17:80427004-80427026 CCACCACCTTCGGGCCGGGGCCT 0: 1
1: 0
2: 0
3: 13
4: 199
Right 1152458002 17:80427028-80427050 CCGGCTGCTGGCGCGCAGTGTGG 0: 1
1: 0
2: 2
3: 13
4: 139
1152457994_1152458003 9 Left 1152457994 17:80427004-80427026 CCACCACCTTCGGGCCGGGGCCT 0: 1
1: 0
2: 0
3: 13
4: 199
Right 1152458003 17:80427036-80427058 TGGCGCGCAGTGTGGCCTCCAGG 0: 1
1: 0
2: 4
3: 8
4: 127

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152457994 Original CRISPR AGGCCCCGGCCCGAAGGTGG TGG (reversed) Intronic
900546966 1:3234654-3234676 AGGCCCTGGCCTGTGGGTGGAGG - Intronic
900648617 1:3720321-3720343 AGGCCCTGTGCCCAAGGTGGGGG + Intronic
901734766 1:11305661-11305683 AGCCCCCGTCCGGGAGGTGGGGG - Intergenic
902293679 1:15451553-15451575 AGCCCCCAGGCAGAAGGTGGAGG - Intergenic
902542128 1:17163005-17163027 AGGCCCCGGGCAGATGGGGGAGG - Intergenic
903121202 1:21218018-21218040 AGGCCCCGAGACGGAGGTGGGGG - Intronic
903353090 1:22730058-22730080 AGGGCCAGGCCCCAGGGTGGGGG + Intronic
904322576 1:29707220-29707242 CGGCCACGGCCTGAAGGTGGCGG + Intergenic
905929797 1:41779065-41779087 AGGCCCAGGCCCAAAGATGCAGG - Intronic
906062467 1:42957998-42958020 AGGCCCGGGCTCGAACGCGGGGG - Intronic
906151100 1:43588200-43588222 AGGCCATGGCCTGGAGGTGGAGG + Intronic
914006670 1:143738338-143738360 AGGACCCGGCCCAGAGGAGGCGG + Intergenic
914095679 1:144542919-144542941 AGGACCCGGCCCAGAGGAGGCGG + Intergenic
914302841 1:146391050-146391072 AGGACCCGGCCCAGAGGAGGCGG - Intergenic
914645494 1:149648823-149648845 AGGACCCGGCCCAGAGGAGGCGG + Intergenic
920969368 1:210729994-210730016 AGGGCCCAGCCAGAAGTTGGGGG - Intronic
922452342 1:225747113-225747135 AGGCCCAGGCCCGAAGGCCCAGG - Intergenic
922790818 1:228309859-228309881 AGGCTTGGGCCCTAAGGTGGAGG + Intronic
1065130127 10:22612343-22612365 AGGCCCAGGCCAGATGGGGGAGG + Intronic
1065528257 10:26643718-26643740 AGGCCCAGGCCCCAAGCAGGAGG + Intergenic
1065558980 10:26943824-26943846 AGGCCCAGGCCCCAAGCAGGAGG - Intergenic
1067478000 10:46578929-46578951 AGGCCCAGGCCCGGCGGTGGAGG - Intronic
1067616739 10:47762858-47762880 AGGCCCAGGCCCGGCGGTGGAGG + Intergenic
1075017881 10:118924379-118924401 TGGCCCCACCCAGAAGGTGGGGG + Intergenic
1075139481 10:119818556-119818578 AGACCCCGGCCCGGCGGGGGAGG - Intronic
1076244324 10:128934221-128934243 CGGCCCAGGCCTGAAGGAGGAGG - Intergenic
1076737682 10:132466074-132466096 ACGCCCGGGCCCGCAGGTTGAGG + Intergenic
1077318069 11:1928102-1928124 AGGCCTGGGCCCGGGGGTGGGGG - Intronic
1079023268 11:16925703-16925725 AGGCCCCGGCGAGGAGGAGGAGG - Intronic
1079450566 11:20597267-20597289 AGGCCCAGGGCCGCAGCTGGGGG + Intergenic
1081692136 11:45085945-45085967 AGTCCCCTGCCTGAAGCTGGGGG + Intergenic
1081692424 11:45087431-45087453 AGGCCCCTGACTGGAGGTGGTGG + Intergenic
1083895665 11:65618590-65618612 CGGCCCCTGCTTGAAGGTGGGGG + Exonic
1084147573 11:67273245-67273267 AGGCCCTTGCCCAAAGGTGTTGG + Intronic
1085232998 11:74989021-74989043 AGGCACCGGCCCCAAGGCTGGGG - Exonic
1085251891 11:75149455-75149477 AGGCCCTGGGGCCAAGGTGGGGG + Intronic
1085288362 11:75378994-75379016 ATGCCCCGTCCGGGAGGTGGGGG - Intergenic
1089591878 11:119546888-119546910 CGTCCCTGGCCTGAAGGTGGGGG - Intergenic
1089817387 11:121188607-121188629 AGGACCCAGCCCGTAAGTGGTGG - Intronic
1091383643 12:78279-78301 AGCACCCGGCCCGAAGGCCGCGG - Intronic
1094653589 12:32399988-32400010 TGGCCCCGGCGCGTAGGTGCGGG + Intronic
1096511699 12:52133597-52133619 AGGCCAAGGACCTAAGGTGGGGG - Intergenic
1098943184 12:76560020-76560042 AGGCGCTGGGCCGACGGTGGTGG - Intergenic
1101422616 12:104562075-104562097 AGGCCCAGCCAGGAAGGTGGGGG - Intronic
1102948492 12:117011233-117011255 CGGCCCCGGGCTGCAGGTGGCGG + Intronic
1105418278 13:20231920-20231942 CGGCCCCGGCCCGATGGCAGTGG - Intronic
1106144574 13:27039819-27039841 AAGCCCAGTCCCAAAGGTGGAGG + Intergenic
1108429360 13:50338763-50338785 AAGCCCAGGTCCGAAGGTGAGGG - Intronic
1115545444 14:34462006-34462028 AGGCCCCGGGCCTGGGGTGGAGG - Intronic
1117899277 14:60515681-60515703 AGGCCCAGGCCCGACGCGGGCGG - Intergenic
1118538309 14:66793073-66793095 AGGCCCACGCCGGAAGGTTGTGG - Intronic
1119391719 14:74295465-74295487 AGGGCCTGGCCCAAAGGAGGGGG + Intronic
1121491265 14:94363180-94363202 AGGCCCCAACCCGGAGGTTGGGG - Intergenic
1122541443 14:102499790-102499812 AGCCCCCAGGCCGCAGGTGGAGG + Exonic
1123037773 14:105478406-105478428 AGGACCCTGCCTGAGGGTGGCGG - Intronic
1125535900 15:40441125-40441147 CGGCCCCGGCCCCCAGGAGGAGG + Intronic
1125577885 15:40767565-40767587 CGGCCCAGGCCCGAAGCAGGAGG - Exonic
1125603405 15:40927600-40927622 AGTCCCAGGCCCGAGGGAGGGGG - Intergenic
1125722993 15:41853996-41854018 GAGCCCCTGCCCGAAGGCGGTGG - Intronic
1125834241 15:42736453-42736475 AGGCCGCGGCCTGGAGGAGGGGG - Exonic
1130411777 15:83654011-83654033 TGGCCCCGGCCCAGAGGCGGAGG - Intergenic
1132483956 16:180741-180763 AGCCCACGGCCAGAAGGTGGCGG + Exonic
1132498162 16:273610-273632 AGGTCCAGGCCTGAGGGTGGGGG - Intronic
1132604471 16:788056-788078 ATGCCTCTGCCCGACGGTGGGGG + Intronic
1133130348 16:3672870-3672892 AGGCCCTGGCTGGGAGGTGGGGG + Intronic
1136185685 16:28587559-28587581 AGGCCAGGGCCAGAAGATGGAGG - Intronic
1136237812 16:28925279-28925301 AGGCCCCGGACGGAGGATGGGGG + Exonic
1136279378 16:29199021-29199043 TGGCCTCAGCCCGAAGGTAGAGG + Intergenic
1136714341 16:32264785-32264807 GTGCCCCGGCCCAAAGGTGCAGG - Intergenic
1136753548 16:32664632-32664654 GTGCCCCGGCCCAAAGGTGCAGG + Intergenic
1136814565 16:33205733-33205755 GTGCCCCGGCCCAAAGGTGCAGG - Intronic
1136821041 16:33315813-33315835 GTGCCCCGGCCCAAAGGTGCAGG - Intergenic
1136827604 16:33372352-33372374 GTGCCCCGGCCCAAAGGTGCAGG - Intergenic
1136832670 16:33471123-33471145 GTGCCCCGGCCCAAAGGTGCAGG - Intergenic
1138104870 16:54282556-54282578 AGGCCCCGGCGCGGGGGTTGCGG - Intergenic
1138527909 16:57619637-57619659 AGGCCCCAGCCAGCAGCTGGTGG - Intronic
1138534408 16:57652436-57652458 AGGCCCAGGCCCGTCAGTGGTGG + Intronic
1138660899 16:58516268-58516290 AGGCCCCGGCCTCACGCTGGAGG + Exonic
1140602984 16:76500234-76500256 CCGCCCCGTCCGGAAGGTGGGGG - Intronic
1140671452 16:77283919-77283941 AGCCCCTGGCCCTAAGGTGCTGG + Exonic
1141396662 16:83711069-83711091 TGGCACCTGCCCCAAGGTGGTGG - Intronic
1142083769 16:88165122-88165144 TGGCCTCAGCCCGAAGGTAGAGG + Intergenic
1202993141 16_KI270728v1_random:28707-28729 GTGCCCCGGCCCAAAGGTGCAGG - Intergenic
1203055707 16_KI270728v1_random:924984-925006 GTGCCCCGGCCCAAAGGTGCAGG + Intergenic
1147586348 17:41655747-41655769 GGGCCCCGGGCTGAAGGTGTGGG + Intergenic
1147651253 17:42063175-42063197 ATGCCCCAGCCCGAGGATGGTGG + Intronic
1148111034 17:45144683-45144705 AGGCCCAGGCCCGGAGGTCAAGG - Intergenic
1148895169 17:50835343-50835365 GGGGCCCGGCCCCAAGGAGGTGG + Intronic
1150128450 17:62653374-62653396 AGACCCCGCCCCGGGGGTGGGGG - Intronic
1150229644 17:63543159-63543181 AGGGCCCTCCCCCAAGGTGGAGG - Intronic
1152457994 17:80427004-80427026 AGGCCCCGGCCCGAAGGTGGTGG - Intronic
1152461650 17:80445102-80445124 AGGCCCCAGCCACAAGGAGGAGG - Intergenic
1152493095 17:80651033-80651055 AGTCCCCAGCCTGACGGTGGGGG - Intronic
1160017951 18:75158524-75158546 AGGTTGCGGCCCGCAGGTGGAGG + Intergenic
1161313350 19:3606918-3606940 AGGCCCGGGCCCGAGGGGCGTGG - Intergenic
1161358642 19:3833917-3833939 AGGCCCTGGCCCGGAGGCAGGGG + Intronic
1161750321 19:6091362-6091384 AGTCCCAGCCCAGAAGGTGGAGG + Intronic
1164835340 19:31351887-31351909 AGGCCGCGGCCCGCAGTGGGAGG - Intergenic
1166851454 19:45763433-45763455 AGGCTCCGGCCCCGAGGTGTGGG + Intronic
1166949249 19:46415586-46415608 AGGCCCCATCCAGAAGCTGGGGG + Intergenic
926035167 2:9630684-9630706 AGGCCGCGGCCCGCGGCTGGAGG + Intronic
927944847 2:27129458-27129480 AGACCGTGGCCAGAAGGTGGAGG - Intronic
928303746 2:30148003-30148025 AGGCCGCAGCCCGAAGCTGGCGG - Intronic
929847166 2:45541983-45542005 AGGCCCTGGCTTGGAGGTGGGGG + Intronic
930727920 2:54699218-54699240 CTGCCCCGTCCCGGAGGTGGAGG + Intergenic
932234342 2:70109064-70109086 AGGCCCCGCCCCGCTGGGGGTGG - Intergenic
932479831 2:72032556-72032578 AGGCCCAGGCCCCTGGGTGGGGG - Intergenic
932767860 2:74482593-74482615 AGGCGGGGGCCCGCAGGTGGCGG - Exonic
932896753 2:75647287-75647309 AGGTCCCGGCTCTAAGGTGGGGG + Intronic
934998451 2:98988769-98988791 CCGCCCCGTCCAGAAGGTGGGGG - Intergenic
935122746 2:100196966-100196988 AGGCCCCAGCGGGAAGGGGGTGG - Intergenic
937221021 2:120343504-120343526 AGGAACCGACCCGAAGCTGGCGG - Intergenic
940638993 2:156329051-156329073 TGGCCCCCGCCCGAAGTTGCTGG - Intronic
941225093 2:162838709-162838731 AGGCCCCCTCCGGAAGGTGAGGG - Intronic
947809969 2:232998058-232998080 GGACCCAGGCCAGAAGGTGGTGG + Intronic
948993419 2:241565660-241565682 AGGCCCCAGCCCTGAGGTGCGGG - Intronic
1169288045 20:4325983-4326005 AGGCCTCGGGCCAAAGGTGGCGG - Intergenic
1172797440 20:37550733-37550755 TGGCCCCGTCCGGGAGGTGGGGG - Intergenic
1173856010 20:46251269-46251291 AGGCCGAGGCCCGAAGGTAGGGG - Exonic
1174357868 20:50010223-50010245 GCGCCCCGGCCGGCAGGTGGAGG + Intergenic
1174954886 20:55086597-55086619 AGGCCACAGCCAGATGGTGGCGG - Intergenic
1175790232 20:61736151-61736173 AGTCCCCACCCCGAAGGTGTAGG + Intronic
1175939880 20:62532986-62533008 ATCCCCAGGCCTGAAGGTGGGGG + Intergenic
1176303832 21:5113358-5113380 AGGCCCGGGCTCTGAGGTGGTGG - Intergenic
1179185800 21:39084430-39084452 AGACACTGGCCAGAAGGTGGAGG - Intergenic
1179853198 21:44148592-44148614 AGGCCCGGGCTCTGAGGTGGTGG + Intergenic
1180064664 21:45406152-45406174 AGGCCCCGGTTAGCAGGTGGTGG - Intronic
1180109862 21:45642850-45642872 TGGCCCCGGCCCGGAGGCTGGGG - Intergenic
1181030471 22:20147005-20147027 ACGCCGCGGCCCGCAGGGGGCGG + Exonic
1181068696 22:20319590-20319612 AGGCGCCGACCCGGAGGAGGCGG + Intronic
1182555290 22:31125710-31125732 GGCCCCAGGCCGGAAGGTGGGGG - Exonic
1183785738 22:40028153-40028175 AGCCTCCTGCCCAAAGGTGGGGG + Intronic
1185258281 22:49848595-49848617 AGGCTCCGGCCCGGAGAAGGGGG + Intergenic
1185278634 22:49960673-49960695 GGGCCCCGGGCGGAAGGGGGCGG + Exonic
950530262 3:13549036-13549058 AGACCCCGCCCCGGAGGCGGAGG + Intergenic
953931794 3:47009372-47009394 AGGCCCCGCCCAGAAGTCGGCGG + Exonic
959067796 3:101676262-101676284 AGGCCCCGGCCCTCTGGAGGTGG - Intronic
960914392 3:122681286-122681308 ATGGCGCGGCCCGGAGGTGGCGG + Intronic
964737474 3:159931407-159931429 AGCCCACAGCCCAAAGGTGGGGG + Intergenic
968578801 4:1380234-1380256 AGGCCGTGGCCCGAGGGCGGGGG + Intronic
968650497 4:1758466-1758488 AGGCCCCGGCTGGAACGGGGCGG + Intergenic
968726807 4:2251639-2251661 AGGCCACAGCCCGATGGGGGCGG - Intronic
977176969 4:93829631-93829653 AGGCCGCGGTGCGAAGGTGGTGG - Exonic
978224933 4:106321560-106321582 CGGCCCCGTCCGGGAGGTGGGGG + Intronic
981993722 4:150954171-150954193 CCGCCCCGTCCAGAAGGTGGGGG + Intronic
982232625 4:153222963-153222985 AGGCCCAGGCCCGAGGGGTGAGG + Intronic
984029624 4:174586824-174586846 CCGCCCCGTCCAGAAGGTGGGGG - Intergenic
984701300 4:182820335-182820357 AAGCCCTGGCCGGATGGTGGTGG - Intergenic
985894593 5:2740785-2740807 AGACCCTGGGCCGAAGGTGCGGG - Intergenic
989372315 5:40722756-40722778 ACGCCCCGTCCCGGAGGTGGCGG + Intronic
989678511 5:44002389-44002411 AGGCCCTGGACAGAGGGTGGGGG - Intergenic
990117758 5:52410098-52410120 AGTCCACGGCCTGGAGGTGGGGG + Intergenic
992162320 5:74015453-74015475 AGGCACCAGCAGGAAGGTGGAGG - Intergenic
997228745 5:132228131-132228153 GGGCCAAGGCCCGCAGGTGGGGG - Intronic
997647457 5:135490706-135490728 AGGCCCCGGCCCTGAACTGGAGG - Intergenic
999441119 5:151601631-151601653 AGTCCCAGGCACGAAGGTGTGGG + Intergenic
1000969729 5:167700378-167700400 AGGCCCCTGCCCAAGGGTTGTGG - Intronic
1001563441 5:172684708-172684730 AGGGCCCGGCCCACAGCTGGTGG - Intronic
1001600716 5:172926448-172926470 AGGGCCAGGCCTGGAGGTGGAGG + Intronic
1002300966 5:178257119-178257141 AGGCCCACACCAGAAGGTGGCGG - Intronic
1002522664 5:179800253-179800275 CCGCCCCGGCCCACAGGTGGAGG - Exonic
1002530589 5:179842186-179842208 AGGCACCGGCTGGAAGGTGATGG + Intronic
1002887841 6:1312074-1312096 TTGGGCCGGCCCGAAGGTGGAGG + Intergenic
1003488128 6:6597158-6597180 AGACCCAGGCCCGCAGGAGGGGG + Intronic
1005860372 6:29895893-29895915 ACGCCCCGTCCGGGAGGTGGGGG - Intergenic
1007464794 6:42044178-42044200 AGGCTCCGGCCAGAACGTGCAGG - Intronic
1014029259 6:116681796-116681818 AGGCACCTGCACGCAGGTGGAGG - Intronic
1019343639 7:519682-519704 AGGCCCCGGGCGGCGGGTGGTGG - Intronic
1019350420 7:551750-551772 AGGACCCGGGCGGGAGGTGGGGG - Intronic
1019350480 7:551935-551957 AGGACCCGGGCGGGAGGTGGGGG - Intronic
1019350592 7:552302-552324 AGGACCCGGGCGGGAGGTGGGGG - Intronic
1019350613 7:552364-552386 AGGACCCGGGCGGGAGGTGGGGG - Intronic
1019480159 7:1262711-1262733 AGGCCCCAGCCCGGAGTTGCTGG + Intergenic
1019605830 7:1909733-1909755 AGGCCCTGGCTGGCAGGTGGTGG - Intronic
1019707299 7:2502745-2502767 AGGGGCAGTCCCGAAGGTGGGGG + Intergenic
1021669642 7:23022533-23022555 TGTGCCCGGCCTGAAGGTGGTGG + Intergenic
1022108523 7:27213692-27213714 ACGTGCCGGCCCGAGGGTGGAGG - Intergenic
1025095580 7:56093067-56093089 AGTCTCCGGGCGGAAGGTGGGGG + Intergenic
1025829807 7:65038758-65038780 AGGCCGCGGGGCGGAGGTGGCGG + Intergenic
1025917062 7:65873758-65873780 AGGCCGCGGGGCGGAGGTGGCGG + Intronic
1026057213 7:66995259-66995281 AGGCCCAGGCCCGAGGGAGGGGG + Intronic
1026720900 7:72829792-72829814 AGGCCCAGGCCCGAGGGAGGGGG - Intergenic
1026959812 7:74400907-74400929 AGCCCCCGGTCTGAAGGGGGAGG + Intronic
1027177587 7:75914769-75914791 AAGCGGCGGCCCGAAGGAGGAGG + Intronic
1028129454 7:87152728-87152750 AGGCCCTGGCCGGAACGTGCGGG - Exonic
1030288374 7:107848450-107848472 CCGCCCCGTCCCGGAGGTGGGGG + Intergenic
1035018715 7:155788027-155788049 CGGTCCAGGCCCGAGGGTGGGGG - Intergenic
1035264751 7:157684771-157684793 AGACCCCGGCCCGGGGGAGGTGG - Intronic
1036595181 8:10205423-10205445 AGGCCCATTCCCAAAGGTGGGGG + Intronic
1037134552 8:15445913-15445935 CCGCCCCGTCCGGAAGGTGGGGG - Intronic
1039905806 8:41785689-41785711 AGGCCCAGGCCCGGAAGTGATGG - Intronic
1039949054 8:42153420-42153442 AGGCCCCGGCCCAGAGCCGGCGG - Intronic
1041416877 8:57620315-57620337 AGGCCTCAGCCTGAAGGAGGTGG + Intergenic
1044758955 8:95496492-95496514 AAGCCCCGGCCTCAAGATGGTGG - Intergenic
1049336660 8:142090186-142090208 AGACCCCAGCCAGAGGGTGGAGG + Intergenic
1049607297 8:143535672-143535694 AGGCCCCGGCCTGCAGATTGTGG - Intronic
1049660158 8:143816197-143816219 GGGCCCCGTCCCGCGGGTGGCGG - Intergenic
1051410666 9:16786694-16786716 AGGCCCTGCCCCAAATGTGGGGG + Intronic
1053397408 9:37787131-37787153 AGGCCGGGACCCGAAGGCGGTGG + Intronic
1055568137 9:77589632-77589654 AGGCCATAGCCCGAGGGTGGAGG - Intronic
1060849952 9:126866374-126866396 AGGCCACAGTCAGAAGGTGGAGG - Intronic
1061275373 9:129567040-129567062 ACGCCCCTTCCCGAAGGCGGAGG - Intergenic
1061431751 9:130535690-130535712 AAGCCTCAGCCCGAGGGTGGGGG + Intergenic
1061745837 9:132739837-132739859 AGGTCCAGGCCCCAAGGGGGAGG + Intronic
1062390927 9:136333568-136333590 AAGTCCCTGCCCGAAGGTGGGGG + Intronic
1062509272 9:136895953-136895975 AGGCCCTGGCCTAAGGGTGGAGG - Intronic
1185507678 X:642522-642544 TGGCCCAGGCCCGAAGGAGAGGG + Intronic
1186466196 X:9786236-9786258 AGCCCGCGGCCCGAAGGGTGAGG - Intronic
1186638143 X:11427788-11427810 AGGCAGCGGCGCGAAGGGGGAGG + Intronic
1192274474 X:69615935-69615957 AGGCCCCGCCCCGCGGCTGGAGG + Intergenic
1196607670 X:117674446-117674468 AGACCCTGGGCCGAAGGGGGAGG + Intergenic
1197726029 X:129777174-129777196 TGGCCCCGGTCCCCAGGTGGCGG + Intergenic
1197767274 X:130067233-130067255 TGGCCCCAGCCAGAAGTTGGGGG + Exonic