ID: 1152458416

View in Genome Browser
Species Human (GRCh38)
Location 17:80428951-80428973
Sequence CAGGCTAAGTGGACTGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 243
Summary {0: 1, 1: 0, 2: 3, 3: 12, 4: 227}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152458416_1152458423 -4 Left 1152458416 17:80428951-80428973 CCTTCCTCAGTCCACTTAGCCTG 0: 1
1: 0
2: 3
3: 12
4: 227
Right 1152458423 17:80428970-80428992 CCTGTGAGGTACCAGGACGTGGG 0: 1
1: 0
2: 0
3: 7
4: 100
1152458416_1152458427 21 Left 1152458416 17:80428951-80428973 CCTTCCTCAGTCCACTTAGCCTG 0: 1
1: 0
2: 3
3: 12
4: 227
Right 1152458427 17:80428995-80429017 CTGCAGAAAAGGCGTGGCCTCGG 0: 1
1: 0
2: 0
3: 14
4: 169
1152458416_1152458421 -5 Left 1152458416 17:80428951-80428973 CCTTCCTCAGTCCACTTAGCCTG 0: 1
1: 0
2: 3
3: 12
4: 227
Right 1152458421 17:80428969-80428991 GCCTGTGAGGTACCAGGACGTGG 0: 1
1: 0
2: 1
3: 10
4: 142
1152458416_1152458426 15 Left 1152458416 17:80428951-80428973 CCTTCCTCAGTCCACTTAGCCTG 0: 1
1: 0
2: 3
3: 12
4: 227
Right 1152458426 17:80428989-80429011 TGGGCTCTGCAGAAAAGGCGTGG 0: 1
1: 0
2: 1
3: 17
4: 187
1152458416_1152458425 10 Left 1152458416 17:80428951-80428973 CCTTCCTCAGTCCACTTAGCCTG 0: 1
1: 0
2: 3
3: 12
4: 227
Right 1152458425 17:80428984-80429006 GGACGTGGGCTCTGCAGAAAAGG 0: 1
1: 0
2: 0
3: 14
4: 224

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152458416 Original CRISPR CAGGCTAAGTGGACTGAGGA AGG (reversed) Intronic
902697304 1:18149048-18149070 CAGGCTAAGTGCATGGAGCAGGG + Intronic
903116298 1:21181225-21181247 TTGGCTAAGGGGAGTGAGGACGG - Intergenic
903224488 1:21887085-21887107 CAGGCTTGGGGGACTGGGGAGGG + Intronic
903230722 1:21920818-21920840 CAGGCTGAGAGGTCTGAGGTGGG + Intronic
904462255 1:30687023-30687045 CAGGCAAAGGAGGCTGAGGAGGG - Intergenic
904593407 1:31627858-31627880 CAGGCCCAGTGGCCTGGGGAAGG + Intronic
904846056 1:33417494-33417516 CAGACAAAATAGACTGAGGAAGG + Intronic
905423606 1:37865464-37865486 CAAGCTAAGTGCAATGAGAATGG + Intronic
905503187 1:38455525-38455547 CTGTCTATATGGACTGAGGATGG + Intergenic
906165795 1:43685128-43685150 GGGGCTAGGTGGACAGAGGAGGG + Intronic
907244409 1:53098957-53098979 CAGGATGAGTGTACTGAGGCAGG - Intronic
907244742 1:53101508-53101530 CAGGGTGAGTGTACTGAGGCAGG - Intronic
908541395 1:65126034-65126056 CTGCCCAAGTTGACTGAGGAGGG + Intergenic
908565258 1:65347978-65348000 CAGCCTTATTGGACTAAGGATGG + Intronic
911030093 1:93478443-93478465 GAGCCTAAGTGGAATGATGAGGG + Intronic
911462021 1:98203107-98203129 CTAGGTGAGTGGACTGAGGATGG - Intergenic
912499470 1:110112512-110112534 CGGGCTGAGTGGAATCAGGAGGG - Exonic
914196779 1:145451871-145451893 CAGGCAAAGTGGGAGGAGGAGGG + Intergenic
915546024 1:156598396-156598418 AAGACTGGGTGGACTGAGGAAGG - Intronic
915724927 1:158010719-158010741 CAGGCAAAGGGGAGGGAGGAGGG - Intronic
921640105 1:217543064-217543086 AAGGCTAAGTGGACTGATGTAGG - Intronic
921968217 1:221116264-221116286 CAGGCTGTGATGACTGAGGAGGG - Intergenic
922931946 1:229396890-229396912 CAGGGTAAGTGGGCTGAGGATGG - Intergenic
924419236 1:243891921-243891943 CAGGCTAAATGGACTGAGAGTGG + Intergenic
1062946409 10:1465124-1465146 CGGGCTCAGGCGACTGAGGACGG + Intronic
1070218180 10:74408822-74408844 CATGTTGAGTGGGCTGAGGAGGG + Intronic
1072597874 10:96892370-96892392 CAGCCCAAGTGGACTAAGAAAGG - Intronic
1072811434 10:98465548-98465570 CAGGTTAAGTGGTCTGGGCAAGG + Intronic
1073163302 10:101420404-101420426 CAGACCCAGTGGAGTGAGGAGGG - Intronic
1074296224 10:112192014-112192036 CAGGCAAGGTGCAATGAGGAAGG + Intronic
1074826745 10:117220288-117220310 CAGGCCTGGTGGACTTAGGAGGG + Intergenic
1075629718 10:123993814-123993836 AAGGCAAAGTGGACAGGGGAGGG + Intergenic
1075797995 10:125134839-125134861 CAGGGTAGGTGGAGTGGGGAGGG - Intronic
1075978005 10:126713529-126713551 CAGGCTAAGTGACCAGAGAATGG - Intergenic
1076216554 10:128698190-128698212 GAGACTTGGTGGACTGAGGATGG - Intergenic
1077147774 11:1053598-1053620 GTGGCTGAGAGGACTGAGGACGG + Intergenic
1078285550 11:9951043-9951065 CAGGCTTCATGGGCTGAGGAAGG + Intronic
1079837362 11:25350969-25350991 CAGGCTCAGCAGACTCAGGAGGG - Intergenic
1081700518 11:45149661-45149683 CAGGGAAAGTGCACTGTGGAGGG - Intronic
1082790004 11:57340583-57340605 CAGGCACTGTGGATTGAGGACGG + Intronic
1083194835 11:61079608-61079630 CAGACTACCTGGACTGAGAAAGG + Intergenic
1083880446 11:65545849-65545871 CAGGCTATGGGGGCTGAGGCTGG - Intronic
1084422471 11:69067201-69067223 CAGGCGAGGTGGCCTGAGGGAGG + Intronic
1084453610 11:69254588-69254610 CAGCCAAAGGGGAATGAGGAGGG + Intergenic
1085473550 11:76773503-76773525 CAGGCAAAGTGTCCTGAGGGAGG - Intergenic
1087586016 11:100122405-100122427 GAGTCTGAGTGGACTGAGCAGGG - Intronic
1087802830 11:102522546-102522568 GAGGCTAAGTGGACTGTCCAAGG - Intronic
1088335804 11:108702399-108702421 CAGGCTAAGAGAACTGAGGGTGG + Intronic
1089189011 11:116640912-116640934 CATGCTAAGTGGCCTGAGGATGG - Intergenic
1089629142 11:119773035-119773057 CAGGGGAAGTGGAAAGAGGAGGG - Intergenic
1090068948 11:123527051-123527073 AAGGCTCCTTGGACTGAGGAGGG + Intronic
1090726942 11:129536514-129536536 TAGGCACAGTGGAATGAGGAAGG - Intergenic
1091076268 11:132620511-132620533 AAGGCTAAGGGGAATCAGGAAGG + Intronic
1092959621 12:13583704-13583726 CAGGCAAAGAGGTCTGGGGAGGG + Intronic
1095662282 12:44751185-44751207 CAGACTAAGTGGAAGGGGGAAGG + Intronic
1095916086 12:47480517-47480539 CAGGCTAAGTTAACTATGGAAGG - Intergenic
1096141165 12:49243712-49243734 AAGGCTAAGAGGACTTGGGAAGG + Intronic
1096699446 12:53372425-53372447 GAGGCTCAGGGAACTGAGGAGGG - Intergenic
1096828873 12:54299554-54299576 CAGGCTAAGAGTAAGGAGGATGG - Intronic
1097072021 12:56362012-56362034 CAGGACAAGGGGTCTGAGGAGGG + Exonic
1097719143 12:63001636-63001658 CAGGGTAAGAGGTCTGGGGATGG - Intergenic
1097996433 12:65892740-65892762 CAGGATGAATGGATTGAGGACGG - Intronic
1099373367 12:81865849-81865871 CAGTCTAAGAGCACTGAGAAGGG - Intergenic
1100955317 12:99901622-99901644 CAGTCTACATGGACTGAGAATGG - Intronic
1102603710 12:114052866-114052888 CAGGCTAAGTGGATCAAGGTGGG - Intergenic
1103092006 12:118104095-118104117 CGGGCGGAGTGGACTGGGGAGGG - Intronic
1104059332 12:125254409-125254431 CAGTCTAAGGGGGCTGATGAAGG - Intronic
1105922877 13:24982086-24982108 CAGGCTAAGTCAGCTGAGGAGGG + Intergenic
1109292321 13:60491653-60491675 CATGTTAAGAGGAATGAGGATGG - Intronic
1109653795 13:65364063-65364085 AAGTCTAAGTGGGTTGAGGAGGG - Intergenic
1110515572 13:76408473-76408495 CAGGCTCAGAGGATAGAGGAAGG - Intergenic
1112167497 13:96935269-96935291 CAGGCTAAGTGGAATAAAAAGGG - Intergenic
1113786000 13:113002354-113002376 CAGGCTATGTGGACAAATGAGGG + Intronic
1114598258 14:23932914-23932936 AGGGCTCAGTGGACTGAGGGTGG - Intergenic
1115682137 14:35752612-35752634 CAGTCTGAGAGGAGTGAGGAGGG + Intronic
1116228379 14:42182594-42182616 CAGAGTAAGTGGCCTTAGGAAGG + Intergenic
1116866691 14:50037275-50037297 CAGACTGAGGGGCCTGAGGAGGG - Intergenic
1117484616 14:56181716-56181738 CAGGCTAAGTCAAATGAGGATGG + Intronic
1118152445 14:63204346-63204368 TAGGATCAGTGGGCTGAGGAAGG - Intronic
1119120910 14:72076179-72076201 CAGGCTAAGGTGCCTGTGGAGGG - Intronic
1121727663 14:96165123-96165145 CAGGATTAGTGGATTAAGGATGG - Intergenic
1122206955 14:100152431-100152453 GAGGGTAAGTGGACTGAGTGAGG + Intronic
1122810815 14:104287012-104287034 GAGGCCACTTGGACTGAGGAAGG + Intergenic
1124112664 15:26806670-26806692 CAGGGAATGTGGACTAAGGAAGG - Intronic
1124631011 15:31337170-31337192 CATGCTAAGTGGCCTGCGGCAGG + Intronic
1126105660 15:45145357-45145379 CAGGCTGAGATGAGTGAGGATGG - Intronic
1128261546 15:66236409-66236431 CAGGGAATGTGGACTGGGGAGGG + Intronic
1128584899 15:68839884-68839906 GAGCCTAAGTGGAATCAGGAGGG + Intronic
1129251901 15:74313845-74313867 CAGGCAAAGTGGACTGGGCTGGG - Intronic
1129324293 15:74791933-74791955 CAGGCTAATTGGAAACAGGAAGG - Intronic
1131566370 15:93489314-93489336 CAGGCAAAGAGAACAGAGGAAGG - Intergenic
1131567108 15:93496231-93496253 CAGGCACAGTGGATTGAAGAGGG + Intergenic
1134081051 16:11325207-11325229 CAGTCAAAGTGGCCTGAGCAAGG + Intronic
1138512578 16:57517094-57517116 CAGGCTGTGTGGGCAGAGGATGG - Intronic
1138588118 16:57984866-57984888 CAGGGAACGTGGACTGCGGACGG + Intronic
1140856436 16:78981856-78981878 CTGGCAAAGTGGACACAGGAAGG - Intronic
1141058601 16:80842748-80842770 GAGGCTAGGTGCACTGAAGAGGG + Intergenic
1141908386 16:87042365-87042387 CAGGCTGGGTGGACTTCGGAGGG - Intergenic
1149305052 17:55339584-55339606 CAGGCTACCAGGGCTGAGGAAGG - Intergenic
1151174150 17:72273427-72273449 CTGGCTCAGAGGCCTGAGGATGG - Intergenic
1151365020 17:73611564-73611586 CATGGTAAGTGGAATGAGCACGG + Intronic
1152181062 17:78822157-78822179 CAGGCAGCGTGGGCTGAGGATGG - Intronic
1152458416 17:80428951-80428973 CAGGCTAAGTGGACTGAGGAAGG - Intronic
1152626510 17:81390251-81390273 CAGGGTAAGGGGGCTGAGGCAGG - Intergenic
1152630649 17:81409384-81409406 CCGGCTGAGTGGCCTGGGGAAGG + Intronic
1153711285 18:7802186-7802208 CAGGCTGAGTGGACTGCCCAAGG - Intronic
1155621518 18:27785518-27785540 CTGGCTATGAGGACTAAGGAAGG - Intergenic
1157784698 18:50471057-50471079 CAGGGTAGCTGGAGTGAGGATGG - Intergenic
1157862435 18:51153248-51153270 CAGGCTGTGTGGTCTGATGATGG + Intergenic
1159789690 18:72763412-72763434 CAAGATGAGTGGACTGGGGAGGG - Intronic
1161658048 19:5527983-5528005 CTGGCTAAGAGGTCTGAGGTAGG + Intergenic
1162607781 19:11724462-11724484 CACACTGAGTGGGCTGAGGAAGG - Intronic
1163620617 19:18357651-18357673 CAGGCTCAGTGGGTGGAGGAGGG - Intronic
1163786336 19:19276851-19276873 CAGCCTGGCTGGACTGAGGAAGG + Intronic
1164480522 19:28607973-28607995 CAGGCTCAGTGGACTCAGGAGGG - Intergenic
1166853042 19:45769415-45769437 CAGGCGCAGTGGAAGGAGGATGG + Intergenic
925266162 2:2568005-2568027 CAGGCGACCTGGGCTGAGGACGG - Intergenic
925732985 2:6935480-6935502 CAGGAAAAGAGGCCTGAGGATGG - Intronic
925971675 2:9110678-9110700 GAGGCAGAGTGGTCTGAGGACGG - Intergenic
926168146 2:10534491-10534513 CATTCTAAGTGGGGTGAGGAGGG - Intergenic
926794595 2:16608473-16608495 ATGGCCAAGTGGAATGAGGACGG + Intronic
927541793 2:23918847-23918869 GAGGTTAAGTGGCCTGTGGAAGG - Intronic
928674378 2:33636072-33636094 CAGGTTAAGTGAACATAGGAAGG - Intergenic
931225709 2:60328178-60328200 CTGGCTAAGGGGCCTGAGGCAGG - Intergenic
931670474 2:64642768-64642790 CAGCCTTGGTGGTCTGAGGAGGG - Intronic
931706799 2:64952894-64952916 AAGGCTAAGAGGTCTCAGGAAGG - Intergenic
937249856 2:120516549-120516571 CAGGCTAAGTGACCTGCCGAAGG - Intergenic
937856828 2:126678442-126678464 CAGGCTCAGTGGGATGGGGAGGG - Intronic
938369609 2:130761025-130761047 CAGTCCCAATGGACTGAGGATGG - Intronic
939375170 2:141355980-141356002 CAGGCTGTGTAGACTGAGGAAGG - Intronic
941289327 2:163655915-163655937 CAGCATAAGTGGACTGAGCTAGG + Intronic
941937871 2:171000609-171000631 TAGGTTGAGTAGACTGAGGAGGG + Intronic
943513389 2:188854412-188854434 CAGCCTAAGTGGACTAAGATTGG + Intergenic
947534745 2:230933598-230933620 AAGCCTAAGGGGACTGAGGGTGG - Intronic
948274699 2:236699446-236699468 AAGGCTTAGAGGACTGAGGATGG - Intergenic
948540170 2:238685571-238685593 CAAGCTCACTGGACTGAGCAGGG + Intergenic
1170368744 20:15625299-15625321 CAGGACATGTGGACTGTGGAAGG + Intronic
1171369253 20:24650404-24650426 CGTGCCATGTGGACTGAGGATGG - Intronic
1174130653 20:48341488-48341510 CTGGCTAGGTGGAGAGAGGAAGG - Intergenic
1175265917 20:57703484-57703506 CAGGCTTGGTGGACAGAGGCTGG - Intronic
1176700083 21:10036086-10036108 CTAGCGAAGTGGAATGAGGAAGG + Intergenic
1176885170 21:14246554-14246576 CAGGCCAAGTTGTATGAGGAGGG - Intergenic
1178063816 21:28881260-28881282 CAATCTAAGTGGCCTGAGTAGGG + Intronic
1179092839 21:38283888-38283910 CAGGCAAAGGAGACTGAGGAGGG - Intronic
1179457426 21:41508643-41508665 CAGCCTAGGCGGACTGGGGAGGG - Intronic
1179786771 21:43734682-43734704 CTGGCTCAGGGGACTGAGGGTGG + Intronic
1182703723 22:32261345-32261367 AAAGCTAAGTGGACTGAGTAGGG - Intergenic
1182912729 22:34000237-34000259 CAGACTAAGTGGACTTCAGAAGG + Intergenic
1184028908 22:41879392-41879414 CAGGCCATGGGGACTGAGCAGGG + Intronic
1184431810 22:44445411-44445433 CAGGCTGTGTGGGCTGAGGTGGG + Intergenic
950540118 3:13607413-13607435 CAGGCTGAGTAGGCTTAGGAGGG + Intronic
950688560 3:14637010-14637032 CAGGATCTGTGGACTGAAGAAGG - Intergenic
950793024 3:15488339-15488361 CAGGCGTAGGGGACAGAGGAAGG + Intronic
951881178 3:27483380-27483402 CAGGCCAAGTAGAAGGAGGAGGG - Intronic
955019220 3:55102626-55102648 CAGCCTGAGTGGACTGAGACAGG + Intergenic
955966625 3:64395693-64395715 GGGGCTGAGTGGACTGAGGTGGG - Intronic
956755494 3:72381948-72381970 CAGGCTATGTGGGATGAGGGCGG + Intronic
956847927 3:73200979-73201001 CAGGCTGAAGGGAATGAGGAGGG - Intergenic
956915871 3:73870202-73870224 CAGGCAAAGGTGGCTGAGGATGG + Intergenic
957040557 3:75332564-75332586 CAGTCTAAGGGGTCAGAGGAAGG + Intergenic
957969388 3:87363658-87363680 CAGGCTAAGAGGATTGAACAAGG + Intergenic
958169190 3:89917090-89917112 GAGGATCAGTGGTCTGAGGAAGG + Intergenic
958552472 3:95635017-95635039 CAGGCTGACTGGTCTGTGGAAGG - Intergenic
962318970 3:134375521-134375543 CAGGGTAAGTGGAGAGAGGAGGG - Intergenic
965933859 3:174081274-174081296 CAGCCTAAATGGACTAAGAAAGG - Intronic
967132923 3:186489096-186489118 CTGGCTATGTGGGATGAGGAGGG - Intergenic
969990202 4:11254177-11254199 TGGGCTGAGTGGAGTGAGGATGG - Intergenic
975480244 4:74870656-74870678 GATGCTAAGGGCACTGAGGAAGG - Intergenic
977569274 4:98612784-98612806 CAGGCTGAGGGGACAGAGTAAGG - Intronic
980080991 4:128343928-128343950 CAGGATGAGTAGGCTGAGGAGGG + Intergenic
980372483 4:131894718-131894740 CTAGCGAAGTGGAATGAGGAAGG + Intergenic
980445250 4:132897606-132897628 CATGTTAAGTAGGCTGAGGAGGG - Intergenic
980722151 4:136712301-136712323 CAGGATAAGGGGAATGAGGCAGG - Intergenic
983444881 4:167837206-167837228 CAGGTTAAATGGACAGGGGATGG - Intergenic
985703381 5:1386856-1386878 CAGGCAAGGAGGTCTGAGGAAGG - Intergenic
985828098 5:2207649-2207671 CACGCAAAGTAGAGTGAGGAAGG + Intergenic
985933738 5:3079233-3079255 CAGGCGGAGTGGGCTGGGGAGGG - Intergenic
986018016 5:3775006-3775028 CAGGATCAGTGGAGTCAGGATGG - Intergenic
987133484 5:14880624-14880646 AAGGCAAAGTGGCCTCAGGAAGG + Intergenic
991630022 5:68647301-68647323 CTGGCCAAGTGGGCTGGGGATGG - Intergenic
995802156 5:116008745-116008767 CAGGCTAAGAGAGGTGAGGAAGG + Intronic
997241670 5:132312424-132312446 CAGGTGAAGGGGACTGAGGGCGG - Intronic
1000298255 5:159931607-159931629 CAGCCTGAATGGACTGAGGCAGG - Intronic
1001719175 5:173842458-173842480 CAGGTTGAGTAGGCTGAGGAGGG + Intergenic
1001952143 5:175823830-175823852 CTGGCTGAGTGGTTTGAGGAGGG - Intronic
1002667382 5:180835160-180835182 CCTGCTCAGTGGACTGAGTAGGG + Intergenic
1003399786 6:5782181-5782203 CAGGCCAAGTCAGCTGAGGAGGG + Intergenic
1003487437 6:6591811-6591833 CAGGCAAAGTGGACTAAAGGAGG + Intronic
1005381357 6:25237398-25237420 CAGCCCCAGTGGAGTGAGGAGGG - Intergenic
1005695769 6:28351340-28351362 GAGCCCAAGTGGAATGAGGAGGG - Intronic
1007284085 6:40735436-40735458 CACACTAAGAGGACAGAGGAGGG + Intergenic
1007820734 6:44558856-44558878 CAGCCACAGTGGGCTGAGGAGGG - Intergenic
1007905812 6:45459775-45459797 CAGGGTAAGGGGACAGAGGGAGG + Intronic
1008879075 6:56362621-56362643 CATGGTAAGTGGACTGGGGGAGG - Intronic
1009050935 6:58275793-58275815 CAGGCAAACTGGTCAGAGGAGGG + Intergenic
1011152804 6:84292492-84292514 TAGGCTAAGTGGAATAAGTAAGG + Intergenic
1014234049 6:118935260-118935282 CAGGCTAAGTGGCCAGAGCAGGG + Intergenic
1015566860 6:134581820-134581842 CAGGCTAAGTGGAGCTAGGGAGG + Intergenic
1018797864 6:167201196-167201218 CCGGCTGTGTGGAGTGAGGATGG - Intergenic
1019906655 7:4070000-4070022 GATGCTAAGAGGACTGTGGATGG - Intronic
1019932269 7:4231542-4231564 CAGCCTGTGTGGACAGAGGAGGG + Intronic
1022409399 7:30126439-30126461 AAGGCTAAATGAACTGATGAGGG + Intronic
1022957782 7:35397325-35397347 CAGGGTGAGGGGACAGAGGATGG - Intergenic
1026451320 7:70532018-70532040 CAGGCTGATTGGTCTGGGGATGG + Intronic
1027716245 7:81674440-81674462 CAAGCTAATTGGAGTAAGGAGGG + Intergenic
1028453797 7:91016547-91016569 CAGGTTGGGTGGGCTGAGGAGGG - Intronic
1033577579 7:142701085-142701107 CAGGCTAAGTAGGCTTAGCATGG - Intergenic
1034217645 7:149420666-149420688 CAGCCTGTGTGGACTGAGTAGGG + Intergenic
1034859327 7:154582477-154582499 CGAGCTGAGTGGACAGAGGAGGG + Intronic
1034889543 7:154827744-154827766 GAGCCCAAGTGGAGTGAGGAGGG + Intronic
1034923801 7:155104459-155104481 CAGGCTGAGTGGAATGTGAAGGG + Intergenic
1036714468 8:11107723-11107745 CAGGCCAAGTGGACTGACCCTGG + Intronic
1037289462 8:17335896-17335918 CAGGCTGTGTGGACTGCTGAGGG + Intronic
1038406284 8:27325261-27325283 CAGGTGGAGTGGACAGAGGATGG + Intronic
1038413339 8:27375255-27375277 CAGGGTAAGGGGACTCAGGAGGG - Intronic
1038624929 8:29182501-29182523 CAGCCTAAGGGGGCGGAGGAGGG + Intronic
1041884480 8:62792662-62792684 AAGGAAAAGTGGATTGAGGAAGG + Intronic
1043401096 8:79885071-79885093 CAGGCTAAGTGGGAGGGGGAAGG + Intergenic
1045842626 8:106597464-106597486 CAGGCTGAATGGACTAAGAAAGG + Intronic
1047853789 8:128887717-128887739 TAGGCTCAGAGGAGTGAGGAGGG + Intergenic
1048219376 8:132527266-132527288 CACGCAAAATGCACTGAGGAAGG - Intergenic
1049932358 9:469717-469739 CAGGCTAGGTGGACACAGGTGGG - Intergenic
1052349828 9:27447331-27447353 CAGGCTTCGTTGACTAAGGAAGG + Intronic
1053124240 9:35566708-35566730 CAGGCTGTGTGGACTGAGTGGGG - Intergenic
1053568936 9:39284251-39284273 GAGGTTGAGTGGAGTGAGGAAGG - Intronic
1053637223 9:40022561-40022583 CTAGCGAAGTGGAATGAGGAAGG + Intergenic
1053768804 9:41442360-41442382 CTAGCGAAGTGGAATGAGGAAGG - Intergenic
1053834902 9:42125286-42125308 GAGGTTGAGTGGAGTGAGGAAGG - Intronic
1054128208 9:61334757-61334779 GAGGTTGAGTGGAGTGAGGAAGG + Intergenic
1054318058 9:63619410-63619432 CTAGCGAAGTGGAATGAGGAAGG + Intergenic
1054547471 9:66353837-66353859 CTAGCGAAGTGGAATGAGGAAGG - Intergenic
1057251710 9:93508512-93508534 CAGGCTGAGTGGCCTGGGGTGGG + Intronic
1058475393 9:105327771-105327793 CAGGATAGGTGTCCTGAGGAAGG - Intronic
1059346529 9:113632651-113632673 GAGGCAAAGTGGGCAGAGGAAGG + Intergenic
1202785095 9_KI270719v1_random:6146-6168 CTAGCGAAGTGGAATGAGGAAGG + Intergenic
1190640772 X:52481606-52481628 CAGGGTCACTGGACTGGGGAGGG - Intergenic
1190646900 X:52531259-52531281 CAGGGTCACTGGACTGGGGAGGG + Intergenic
1192659879 X:73030792-73030814 CAGGCAAAGTGGCATGAGGGAGG - Intergenic
1192983039 X:76367287-76367309 CAGGCAAAGTGGCTTGGGGAAGG + Intergenic
1195857839 X:109349740-109349762 CAGGGGAGGTGGACTCAGGAGGG + Intergenic
1196253239 X:113486238-113486260 CAGGCACAGTGGACTGGGGGTGG - Intergenic
1196378332 X:115060545-115060567 CAAGCTAAGTTAACTGATGAAGG + Intergenic
1200151435 X:153953302-153953324 CAGGCCAGGGTGACTGAGGACGG - Intronic