ID: 1152458463

View in Genome Browser
Species Human (GRCh38)
Location 17:80429332-80429354
Sequence GTGTGGGCAGTTTGGATTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 210
Summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 193}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152458463 Original CRISPR GTGTGGGCAGTTTGGATTCC AGG Intronic
900610855 1:3544078-3544100 GTGTGGTCAGTCTGTCTTCCGGG + Intronic
903498980 1:23791517-23791539 TTGTGGGCAGGTGGGAGTCCTGG + Intronic
904459437 1:30667072-30667094 GAGTTGGCAGTTTGGTTTTCAGG - Intergenic
906641855 1:47445712-47445734 GTCTGTGCAGTTCGGACTCCTGG + Intergenic
907087224 1:51686699-51686721 GTGTGGGAGGTTTGGAAACCTGG + Intronic
907501979 1:54887442-54887464 GGGTGGGCAGTTGGGACTCAGGG + Intergenic
911871386 1:103105168-103105190 GTGTGGTCACTATGAATTCCAGG + Intronic
917737213 1:177932399-177932421 GTGTGGGCAGTGCTGACTCCTGG - Intronic
924382819 1:243480167-243480189 TTGCGGGGAGTATGGATTCCAGG + Intronic
1067083775 10:43227699-43227721 GTGTGGGCAGTCTAGAGTCCAGG - Intronic
1069295560 10:66839896-66839918 GAATGGGCAGTGTAGATTCCTGG - Intronic
1072847980 10:98853636-98853658 CAGTGGGCAGTTGGGATTCATGG - Intronic
1073289876 10:102408343-102408365 GTGTGCCCAGTTGGGATGCCTGG - Intronic
1076508870 10:130998318-130998340 GTGTGGGCAGAGAGGGTTCCAGG + Intergenic
1080036205 11:27714244-27714266 GTGTGGGCATTTTGACATCCAGG - Intronic
1080614126 11:33931411-33931433 GTGTGGGCAGTTTGGAGGCAGGG + Intergenic
1081119635 11:39249862-39249884 GTGTGTGCATTGTGGATTACTGG - Intergenic
1085837376 11:79971497-79971519 GTATGTGGAGTTTGCATTCCAGG + Intergenic
1091773608 12:3169819-3169841 GGGTGGGCAGGGTGGCTTCCTGG + Intronic
1092810559 12:12267647-12267669 CTGGGGGCAGTTTGTATTTCTGG - Intergenic
1094042593 12:26133376-26133398 GTGTGGGCAGTTAGGATGAAAGG - Intronic
1096469274 12:51865982-51866004 GTGGGGTGAGTTTGGAATCCCGG - Intergenic
1096513884 12:52145997-52146019 TTGTGGGCAGTGTGGATGCTGGG + Intergenic
1096786188 12:54018425-54018447 GTGGAGGCAGTGAGGATTCCGGG + Intronic
1097727789 12:63094552-63094574 GTGAGAGCAGTTTTGATACCTGG - Intergenic
1097860669 12:64515449-64515471 ATGTGGACAGTTTGTTTTCCAGG + Intergenic
1101631996 12:106504219-106504241 CTGTGGGCAGTGTGGACTTCTGG + Exonic
1104592880 12:130098772-130098794 GTGATGGCAGATGGGATTCCAGG - Intergenic
1104878345 12:132052369-132052391 GCGTGGGCAGTAGGGAGTCCTGG - Intronic
1105026133 12:132850381-132850403 GAGTGAAGAGTTTGGATTCCTGG + Intronic
1105031146 12:132884735-132884757 GTGTTGGCAGATTGGGTTCCTGG - Intronic
1105957693 13:25300181-25300203 GATGGGGCAGTTTGGGTTCCAGG + Intergenic
1106411218 13:29512988-29513010 ATGTGGGCATTTTGGACACCAGG - Exonic
1109191417 13:59328242-59328264 GGGTGGGTTGCTTGGATTCCAGG + Intergenic
1109762294 13:66845461-66845483 GTGTGGGCAGGGAGGCTTCCTGG + Intronic
1111756277 13:92399598-92399620 GTGTTGCCACATTGGATTCCAGG + Intronic
1114887390 14:26870786-26870808 GTGGGGGCTGTTTGGAATCAAGG + Intergenic
1117252831 14:53953225-53953247 GTGAGGGCAGAGTGAATTCCGGG + Intronic
1202835783 14_GL000009v2_random:76614-76636 GGGTGGGCAGCTTGGTTTCAGGG + Intergenic
1202837828 14_GL000009v2_random:91358-91380 GGGTGGGCAGTTGGGGTTCAGGG + Intergenic
1202907194 14_GL000194v1_random:81370-81392 GGGTGGGCAGTTGGGGTTCAGGG + Intergenic
1123974812 15:25543214-25543236 GTTTGGGCAGTTTGGGGTCTGGG + Intergenic
1124866359 15:33495983-33496005 GTGTGTGTAGTTTGTATTTCAGG - Intronic
1126225128 15:46261618-46261640 GTGTGGCCAGGCTGGAGTCCTGG + Intergenic
1127505690 15:59595862-59595884 CTGTGGGAAGCTTGGGTTCCGGG - Intronic
1128611368 15:69076214-69076236 GTGTTTGCATTTTGGGTTCCTGG + Intergenic
1129191773 15:73941733-73941755 GTGTGGGCAGGGGGGACTCCAGG - Intronic
1130226158 15:82059608-82059630 GTGTGGCCACTTTTGATTCTGGG - Intergenic
1133280927 16:4664906-4664928 GTGTGAGCAGCTTGGAGTCCCGG + Intronic
1135398918 16:22152239-22152261 GTGTGGGCTGTGTGGTTTCAGGG + Intronic
1136298359 16:29316671-29316693 GTGTGGTCAGTGTGGGCTCCAGG + Intergenic
1137874832 16:51986098-51986120 GTATGTGCATTTTGGACTCCTGG - Intergenic
1142354796 16:89597294-89597316 ATGTGGGCACTTTGGAAGCCAGG - Intergenic
1143159230 17:4858234-4858256 GTGTGGGCCTTCTGGATTACAGG + Intronic
1143184215 17:5000673-5000695 GAGTGGGATGCTTGGATTCCAGG + Intronic
1143462142 17:7110508-7110530 CTGTGGGCAGTCTGGTTTCAGGG - Intronic
1143676881 17:8439983-8440005 ACTTGGGCAGTTTGGCTTCCCGG + Intronic
1146111037 17:30089740-30089762 GTGTGGGCAGTTTGGGCTGGGGG - Intronic
1149300597 17:55301785-55301807 GTGTTGGCAGATGGGATTGCAGG + Intronic
1151666742 17:75549609-75549631 GTGTGGCCAGCTCAGATTCCTGG - Intronic
1152458463 17:80429332-80429354 GTGTGGGCAGTTTGGATTCCAGG + Intronic
1152522660 17:80868404-80868426 GTGGGTGCAGTTTGCATTTCTGG - Intronic
1152705027 17:81838916-81838938 GTATGGACAGTTGGAATTCCAGG + Intergenic
1155262362 18:24056314-24056336 GTGTGGGGGGTTTCGACTCCTGG - Intronic
1157311983 18:46559727-46559749 GTGTGGGCAGTTTCAGTCCCAGG - Intronic
1158797103 18:60859949-60859971 GTGTCAGCAGATTGGATTCCTGG - Intergenic
1160685894 19:436475-436497 GGGTGGGCAGCTGGGAATCCCGG - Intronic
1163316779 19:16545944-16545966 GTGTGGGCACTTTTCATGCCAGG + Intronic
1167494834 19:49811589-49811611 GGGTGGGAAGTTAGGATACCTGG - Intronic
1167689153 19:50974980-50975002 CTGGGGGGAGTCTGGATTCCTGG + Intergenic
1167689322 19:50975441-50975463 CTGGGGGGAGTCTGGATTCCTGG + Intergenic
1167689366 19:50975565-50975587 CTGGGGGGAGTCTGGATTCCTGG + Intergenic
1167689394 19:50975642-50975664 CTGGGGGGAGTCTGGATTCCTGG + Intergenic
1168061933 19:53898102-53898124 TTTTGGGAAGGTTGGATTCCTGG + Exonic
1168280421 19:55302552-55302574 GTCTGGGGCGTCTGGATTCCTGG + Intronic
1202634819 1_KI270706v1_random:35980-36002 GGGTGGGCAGTTGGGGTTCAGGG - Intergenic
1202650400 1_KI270706v1_random:174125-174147 GGGTGGGCAGTTGGGGTTCAGGG + Intergenic
1202650719 1_KI270707v1_random:1070-1092 GGGTGGGCAGTTGGGGTTCAGGG + Intergenic
927946044 2:27135797-27135819 GAGGGGGCAGTTTGGCTCCCGGG + Intergenic
927948225 2:27150069-27150091 GTCAGGGCAGTTGGGAGTCCAGG + Intronic
928603921 2:32926831-32926853 GGGTGGGGAGGTTGGATTTCAGG - Intergenic
928748420 2:34442891-34442913 CTGTGGGCATTTTGGGGTCCAGG + Intergenic
934555802 2:95286567-95286589 TTGTGGTCAGTTTGGAGGCCCGG + Exonic
934560211 2:95309291-95309313 TGGTGGGCAGTTTGGATGTCAGG + Intronic
935406786 2:102718281-102718303 GTGTGAGCTGTTGGGCTTCCAGG - Exonic
936520365 2:113208323-113208345 TTGTGGACAGTTAGAATTCCAGG - Intronic
937643283 2:124237430-124237452 GTGTGTGCAGTTTGGAATGCAGG + Intronic
938994926 2:136668194-136668216 ATGTGGGCACCTTGGAGTCCAGG + Intergenic
941516815 2:166490784-166490806 GGGAGGGCAGGTTGGAATCCTGG - Intronic
943043339 2:182828857-182828879 GTGTGGGCAGCTGTGGTTCCAGG + Intergenic
944513662 2:200489865-200489887 CTATGGGCAGTTTGAATTTCTGG - Exonic
945051809 2:205831048-205831070 TAGTGGGCAGATTGAATTCCAGG - Intergenic
945721204 2:213421158-213421180 GTGGGGGCAGGGTGGCTTCCTGG - Intronic
946320360 2:218950499-218950521 GTGGGGGCAGTGTGGATTTATGG + Intergenic
948619126 2:239222885-239222907 GTGTGGCCAGTTTTGAATCCAGG - Intronic
948969623 2:241414924-241414946 GCTTGGGCAGTTTGGGTTCAAGG + Intronic
1171880975 20:30617165-30617187 GGGTGGGCAGTTGGGGTTCAGGG - Intergenic
1172583619 20:36066808-36066830 GTGTGGGCAGTGGGGCTTCCCGG + Intergenic
1175660495 20:60808390-60808412 GGGTTGGCACTTTGTATTCCAGG + Intergenic
1176601411 21:8798440-8798462 GGGTGGGCAGTTGGGGTTCAGGG - Intergenic
1176626559 21:9096289-9096311 GGGTGGGCAGTTGGGGTTCAGGG + Intergenic
1176647032 21:9361749-9361771 GGGTGGGCAGTTGGGGTTCAGGG - Intergenic
1179311708 21:40201958-40201980 ATGTGGAGAGTTTGAATTCCAGG - Intronic
1179447797 21:41445336-41445358 GTGTGGGCCATTTGACTTCCTGG - Intronic
1179577035 21:42314310-42314332 GTGAGCGAAGTTTGGATGCCAGG - Intronic
1179634312 21:42697618-42697640 GTGTGGGCAGGTTCTGTTCCTGG + Intronic
1180343696 22:11689977-11689999 GGGTGGGCAGTTGGGGTTCAGGG - Intergenic
1180364013 22:11923564-11923586 GGGTGGGCAGCTTGGTTTCAGGG + Intergenic
1180365890 22:11937248-11937270 GGGTGGGCAGTTGGGGTTCAGGG + Intergenic
1180417072 22:12777154-12777176 GGGTGGGCAGTTGGGGTTCAGGG + Intergenic
1183585324 22:38749999-38750021 GTGTGGGCAGGTGGGATCCAAGG - Intronic
1185208865 22:49555505-49555527 GTGAGGGAAGAGTGGATTCCAGG - Intronic
1185250714 22:49800204-49800226 TTCTGAGCAGTTTGGAGTCCGGG - Intronic
950041273 3:9920849-9920871 GTGGGGGCAATTTGGCTCCCAGG - Intronic
950520419 3:13494774-13494796 GTGTGGGCAGGCTGGGTGCCTGG + Intronic
950764159 3:15260946-15260968 GTGTGTGCAGTGTGAATTCGGGG + Intronic
953097521 3:39793288-39793310 GTTTGGGCAATTTGGATTTCTGG - Intergenic
959712960 3:109403089-109403111 GTGTTGGCAGATTCGGTTCCTGG + Intergenic
960769612 3:121178998-121179020 GTGTGGGCACTTGGCATTACAGG + Intronic
961128347 3:124442196-124442218 GTGTGGGCAGTAATGATTCATGG + Intronic
962519807 3:136187996-136188018 GTGTGGAGAGTTTTGATCCCAGG - Intronic
964361485 3:155902120-155902142 ATGTGGCCAGTATGGATTCCTGG - Intronic
964660448 3:159114767-159114789 GTTTTGGCAGTTTGGAAACCAGG - Intronic
964844299 3:161028904-161028926 CTGTGGTCAGTATGGATTCAGGG + Intronic
967070737 3:185960474-185960496 GTGTGGGAAGTTTGCATTCCTGG + Intergenic
1202739850 3_GL000221v1_random:43243-43265 GGGTGGGCAGTTGGGGTTCAGGG + Intergenic
968688170 4:1975436-1975458 GTGTTGGCATTTTGCACTCCTGG + Intronic
968809559 4:2793673-2793695 CAGAGGGAAGTTTGGATTCCGGG - Intronic
968865422 4:3207576-3207598 GTGGAGGCAGTTTGCACTCCTGG + Intronic
968879468 4:3291927-3291949 GTGTGATTAGTTTGGATCCCAGG - Intergenic
969199174 4:5588510-5588532 GTGTGGGTAATTGGAATTCCTGG - Intronic
970897251 4:21118264-21118286 GAGTTTGCAGTTTGGCTTCCTGG - Intronic
973364736 4:49200232-49200254 GGGTGGGCAGTTGGGGTTCAGGG - Intergenic
973855434 4:55006355-55006377 GGGTGTGCCCTTTGGATTCCAGG - Intergenic
976205282 4:82618322-82618344 GAGTGACAAGTTTGGATTCCAGG + Intergenic
982382125 4:154760445-154760467 GTGTTGGCAGATTCCATTCCTGG - Intergenic
983732473 4:171012469-171012491 GTGTGAGGAGTTTGGATTGTTGG - Intergenic
983755595 4:171330593-171330615 GTGTGGAAAGTGTGGATCCCCGG - Intergenic
984473424 4:180206197-180206219 TTTTGGCCAGATTGGATTCCTGG - Intergenic
984953312 4:185021770-185021792 GTGAGGAAAGTTTGGAATCCAGG + Intergenic
1202764172 4_GL000008v2_random:136620-136642 GGGTGGGCAGCTTGGTTTCAGGG - Intergenic
985592594 5:773392-773414 ATGTGAGCAGTTTGTCTTCCTGG - Intergenic
989247490 5:39270221-39270243 TTATGAGCAGTTTGGATCCCAGG - Intronic
998172403 5:139880407-139880429 GGGTGGGCAGCTTGGATGCCTGG - Intronic
999869206 5:155731569-155731591 GTGTAGGAAGTTTAGATTCTTGG + Intergenic
1001264758 5:170265811-170265833 GTGGGGGCAGCTGGGATTCTGGG + Intronic
1001691780 5:173638752-173638774 GAGAGGGCAGATTGGATTACGGG - Intergenic
1002442896 5:179273503-179273525 GTGTGGGCAGATTCAATCCCCGG - Intronic
1003146204 6:3512626-3512648 CTGTGGGCTTTTTGGTTTCCTGG + Intergenic
1004005488 6:11633956-11633978 GTGTGTGCAGTTTGAATTGGGGG + Intergenic
1005774170 6:29112049-29112071 GTGTGTGCAGATGGGAGTCCAGG - Exonic
1007630687 6:43271644-43271666 GTGTGGACAGTTTGGCTCCAGGG - Intronic
1010911037 6:81556794-81556816 GTGTGGGTTGTTTGGTTTCTTGG + Intronic
1014160018 6:118157199-118157221 GTGAGGGCAGTGTGGCTTCAGGG + Intronic
1014197426 6:118576189-118576211 AGGGGGGCAGTTTGGATTCTTGG - Intronic
1015276159 6:131385300-131385322 GGGTGGGCAGATAGGCTTCCAGG + Intergenic
1015914181 6:138198702-138198724 GTGTAGGCAGTTTGGATATGTGG - Intronic
1016909135 6:149179585-149179607 TTGTGGGTAATTTGCATTCCTGG + Intergenic
1018872377 6:167793113-167793135 GTCAGGGCATTTGGGATTCCAGG + Intronic
1019559769 7:1650236-1650258 GTGGGGGGAGTTTCGAGTCCTGG + Intergenic
1022584744 7:31597227-31597249 ATGTGGGCAGGTTGTATTCCTGG - Intronic
1024031015 7:45459834-45459856 GTTTAGGCAGTTTGGCTTTCTGG - Intergenic
1024037590 7:45522020-45522042 GTGTGGGCAGATTCGATTCCTGG + Intergenic
1024273673 7:47660303-47660325 GGGTGGGCAGGTGGGGTTCCTGG + Exonic
1024963733 7:55004269-55004291 GTGTGGGCAGCTTCCCTTCCCGG + Intergenic
1025190560 7:56892671-56892693 GTGTGTGCAGTGTGGATGGCAGG + Intergenic
1025190598 7:56892894-56892916 GTGTGTGCAGTGTGGATTGCAGG + Intergenic
1025681345 7:63684026-63684048 GTGTGTGCAGTGTGGATTGCAGG - Intergenic
1025681354 7:63684082-63684104 GTGTGTGCAGTGTGGATGGCAGG - Intergenic
1025681364 7:63684138-63684160 GTGTGCGCAGTGTGGATGGCAGG - Intergenic
1028391737 7:90325104-90325126 TTCTGGGCAGTTGGGATTACAGG - Intergenic
1029666383 7:101997748-101997770 GTGTGTGCAGTGCGGATTGCAGG + Intronic
1029666456 7:101998198-101998220 ATGTGTGCAGTGTGGATTGCAGG + Intronic
1031645130 7:124216316-124216338 GTGTAATCAGTTTGGATTACTGG - Intergenic
1031899145 7:127391770-127391792 GTGTGGGGAGTTTGGGCTGCAGG - Intronic
1032868256 7:135951549-135951571 TTGTGGGCAGCTTGAAATCCTGG - Exonic
1038330905 8:26608563-26608585 GTGTGGACAGCTGGGAGTCCAGG - Intronic
1039415174 8:37387098-37387120 GTGTGGGCAAATGGGGTTCCTGG - Intergenic
1039769699 8:40672432-40672454 GTGTGGAAAGTTTGGTTTCAAGG + Intronic
1039775007 8:40726930-40726952 GTGTGGCCAGTATGAAATCCAGG - Intronic
1044998144 8:97856622-97856644 ATGTGGGCAGTCTGGAGTTCTGG + Intergenic
1047803749 8:128337100-128337122 ATGTGGGCAAATTGGATCCCTGG - Intergenic
1048277284 8:133076506-133076528 GAGTGGGCAGTTTGCTTTACAGG + Intronic
1050619225 9:7435089-7435111 GTTTGGGCTGTTTGGTTTGCTGG - Intergenic
1052169625 9:25377309-25377331 GTGTGAGCAGTTTTGGTTGCCGG + Intergenic
1052616474 9:30848652-30848674 GTGTGGGCCATATGGATTTCTGG - Intergenic
1052973717 9:34397439-34397461 GTATGGCCAGTCTGGATGCCTGG - Intronic
1054893284 9:70276844-70276866 GTATGGGTAGTTTTGATTTCTGG + Intronic
1058436577 9:104968911-104968933 GAGGGGGCAGCTTGAATTCCGGG - Intergenic
1058548893 9:106092179-106092201 GAGTGGGCAGCTTTGATGCCTGG + Intergenic
1058570070 9:106332086-106332108 GTGTTGGCAGTGTGGGTTTCTGG + Intergenic
1058800073 9:108537196-108537218 GTGAGGTGAGTTTGGATTCATGG + Intergenic
1060001297 9:119961406-119961428 GAGTGTGCAGTGTGGAGTCCAGG - Intergenic
1060726000 9:126006342-126006364 ATGAAGGCTGTTTGGATTCCTGG + Intergenic
1060812177 9:126615962-126615984 GTGTGGGGGTTTGGGATTCCTGG + Intronic
1203749732 Un_GL000218v1:66703-66725 GGGTGGGCAGTTGGGGTTCAGGG + Intergenic
1203708493 Un_KI270742v1:73200-73222 GGGTGGGCAGTTGGGGTTCAGGG + Intergenic
1203544920 Un_KI270743v1:121493-121515 GGGTGGGCAGCTTGGTTTCAGGG - Intergenic
1190319805 X:49173318-49173340 GTCTGGGCAGTTAGGATTGTCGG + Intronic
1192762104 X:74104594-74104616 GTGTGGGTACTTCAGATTCCTGG - Intergenic
1193502347 X:82294510-82294532 GATTGGGCAGATGGGATTCCTGG + Intergenic
1194533571 X:95079033-95079055 GTGTGGGAAGTTTGCAGTTCAGG - Intergenic
1197494165 X:127156635-127156657 GTGTGGGAACTTTGGAATTCAGG + Intergenic
1198934411 X:141890905-141890927 GTGAAAGCAGCTTGGATTCCTGG + Intronic
1198935700 X:141901159-141901181 GTGACAGCAGCTTGGATTCCTGG + Intergenic
1199760909 X:150903383-150903405 GAGAGAGGAGTTTGGATTCCTGG + Intergenic
1199950877 X:152705081-152705103 GTGGAAGCAGCTTGGATTCCTGG + Intergenic
1199958805 X:152763380-152763402 GTGGAAGCAGCTTGGATTCCTGG - Intergenic
1201782676 Y:17740753-17740775 GTATGGGCATTTGGGGTTCCTGG - Intergenic
1201818877 Y:18165235-18165257 GTATGGGCATTTGGGGTTCCTGG + Intergenic