ID: 1152458497

View in Genome Browser
Species Human (GRCh38)
Location 17:80429484-80429506
Sequence GCTCATTTTCCCTCTAAGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 143
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 131}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152458493_1152458497 14 Left 1152458493 17:80429447-80429469 CCCACGATTAGTTACTGAAGGGC 0: 1
1: 0
2: 0
3: 3
4: 33
Right 1152458497 17:80429484-80429506 GCTCATTTTCCCTCTAAGCCAGG 0: 1
1: 0
2: 0
3: 11
4: 131
1152458494_1152458497 13 Left 1152458494 17:80429448-80429470 CCACGATTAGTTACTGAAGGGCT 0: 1
1: 0
2: 0
3: 3
4: 37
Right 1152458497 17:80429484-80429506 GCTCATTTTCCCTCTAAGCCAGG 0: 1
1: 0
2: 0
3: 11
4: 131
1152458488_1152458497 24 Left 1152458488 17:80429437-80429459 CCTGCCCTCGCCCACGATTAGTT 0: 1
1: 0
2: 0
3: 4
4: 46
Right 1152458497 17:80429484-80429506 GCTCATTTTCCCTCTAAGCCAGG 0: 1
1: 0
2: 0
3: 11
4: 131
1152458489_1152458497 20 Left 1152458489 17:80429441-80429463 CCCTCGCCCACGATTAGTTACTG 0: 1
1: 0
2: 0
3: 2
4: 26
Right 1152458497 17:80429484-80429506 GCTCATTTTCCCTCTAAGCCAGG 0: 1
1: 0
2: 0
3: 11
4: 131
1152458487_1152458497 25 Left 1152458487 17:80429436-80429458 CCCTGCCCTCGCCCACGATTAGT 0: 1
1: 0
2: 0
3: 4
4: 51
Right 1152458497 17:80429484-80429506 GCTCATTTTCCCTCTAAGCCAGG 0: 1
1: 0
2: 0
3: 11
4: 131
1152458490_1152458497 19 Left 1152458490 17:80429442-80429464 CCTCGCCCACGATTAGTTACTGA 0: 1
1: 0
2: 0
3: 1
4: 25
Right 1152458497 17:80429484-80429506 GCTCATTTTCCCTCTAAGCCAGG 0: 1
1: 0
2: 0
3: 11
4: 131

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152458497 Original CRISPR GCTCATTTTCCCTCTAAGCC AGG Intronic
900755449 1:4431325-4431347 GCCCATTCTCCCTCCAACCCTGG + Intergenic
901689204 1:10961452-10961474 GCTCATCTCCGCTCTGAGCCCGG - Intronic
902141854 1:14363400-14363422 ACTCATTTTCCCTCTAATCAAGG + Intergenic
902863203 1:19260488-19260510 GCTGCTTTCCCCTCTCAGCCCGG - Intergenic
905309712 1:37041003-37041025 GCTCATCTCCACTCCAAGCCTGG - Intergenic
907417778 1:54326392-54326414 CCTCCTTTTCCTTCCAAGCCTGG + Intronic
908427027 1:64017464-64017486 GGTCATTTTCCCTCTATTTCCGG - Intronic
912039103 1:105362980-105363002 GCTCATTTTCTCTAGATGCCGGG + Intergenic
914846530 1:151286781-151286803 GCTCATTTTGGCCCTGAGCCAGG + Exonic
916463158 1:165047345-165047367 GCTCACTTTCCCTCTGTGCAAGG + Intergenic
916590140 1:166182241-166182263 GATCATGTTACCTCCAAGCCTGG + Intergenic
917597847 1:176547596-176547618 GCTCATTTTCCCTCTACACAGGG + Intronic
918028125 1:180774187-180774209 GCTCAAATTCCCTCAAAGCCAGG - Intronic
918057446 1:181034316-181034338 CCTCACTTTCCCTCTGAGCATGG + Intronic
918655197 1:187017179-187017201 TATCATTTTCCTTCTAAACCTGG - Intergenic
920732327 1:208499001-208499023 ACTCATTTTCCCAGTAAGCAGGG + Intergenic
921152383 1:212412751-212412773 GCACATGTTCCTGCTAAGCCAGG + Intronic
1063058460 10:2526455-2526477 GCTCAGTGTCCTTCTAAGCAGGG + Intergenic
1063214244 10:3909692-3909714 GCTGATGTTCCCTCTGTGCCTGG + Intergenic
1065828295 10:29591856-29591878 GCTCATCTTCCTCCTAAGCCAGG - Intronic
1065930560 10:30475264-30475286 ACTCATTTTCCCTCTTCACCAGG - Intergenic
1066043752 10:31578870-31578892 GCTCCTTGTTCCTCCAAGCCAGG - Intergenic
1066525142 10:36269970-36269992 GAACATTTTCCCACTAAGACTGG + Intergenic
1069106723 10:64392567-64392589 TCTCAACTTCTCTCTAAGCCTGG - Intergenic
1071930622 10:90465742-90465764 GCTCCTCTTTCCTCTGAGCCAGG + Intergenic
1072813324 10:98480616-98480638 GCTTATTTTCCCTCCAACCAAGG - Intronic
1081775976 11:45676150-45676172 GCTGACATTCCCTCTAATCCAGG + Intergenic
1085275304 11:75294709-75294731 ATTCAGTTTCCTTCTAAGCCTGG + Intronic
1086654773 11:89340602-89340624 GCTCATTTTGCCAAAAAGCCAGG - Intronic
1086939577 11:92781381-92781403 GCTTATTTTCCCTATAACTCTGG + Intronic
1087266057 11:96062633-96062655 GCTAATTTTACCTCTTAGACAGG + Intronic
1089737190 11:120557608-120557630 GCTCATTTTCAGCCTGAGCCTGG - Intronic
1090328080 11:125905948-125905970 GCTCATTTTTCCTCTAAAAGAGG - Intronic
1093116695 12:15220989-15221011 GGGCATTTTCCCTCTCAGCTAGG + Intronic
1093162350 12:15763214-15763236 ACTCATTTTCCCTCCTATCCAGG - Intronic
1093386730 12:18566213-18566235 GTTCATTTCCCCTCCAAGCATGG + Intronic
1098952046 12:76649439-76649461 GATCATTTCCCCTCTCAACCTGG + Intergenic
1102477909 12:113200801-113200823 TCTCCTTTTCCACCTAAGCCAGG + Intronic
1106300905 13:28464426-28464448 GCACTTTTTCCCACTAAGCCTGG + Intronic
1109711957 13:66173354-66173376 CCTCATTTTCACTTTATGCCTGG - Intergenic
1112847017 13:103655833-103655855 GCTAATATTACCTCAAAGCCAGG - Intergenic
1114898326 14:27023065-27023087 AATCCTTTTCCCTCCAAGCCTGG - Intergenic
1116993702 14:51301487-51301509 TCTCTTTATCCCTTTAAGCCTGG + Intergenic
1126434957 15:48627580-48627602 GCTCATTGTCTTCCTAAGCCGGG - Intronic
1127811136 15:62566530-62566552 GCTCACTTCCCTCCTAAGCCTGG - Intronic
1132107520 15:99074081-99074103 GCTTATTTTCCCAAAAAGCCTGG + Intergenic
1132164017 15:99566623-99566645 TCCCCTTTTCCCTCCAAGCCCGG + Intronic
1132933278 16:2469271-2469293 GCTCAGCTTCCCTGTGAGCCAGG - Intergenic
1132972887 16:2697522-2697544 TGGCATTTTCCCTCCAAGCCTGG - Intronic
1134819623 16:17236285-17236307 GCTCACTTTCACTCTTAGCATGG - Intronic
1134890397 16:17836738-17836760 GCTCATTTTCTCTCTTTCCCTGG + Intergenic
1135078100 16:19411201-19411223 GCTCATGTTCGCTCTCACCCAGG - Intronic
1135235283 16:20749572-20749594 GCTCAGTTTCTCACTCAGCCAGG - Intronic
1135852859 16:25980393-25980415 ACTCTTTTTCCCTCTAAGGCAGG + Intronic
1137505690 16:49051938-49051960 GCTCATTTCCCCTGTAAGATTGG + Intergenic
1139799118 16:69506889-69506911 GCTCATTCTCTCTCTCAGGCTGG - Intergenic
1140032115 16:71347236-71347258 ACTTTTTTTCCCTCTAGGCCTGG - Intergenic
1140871376 16:79109791-79109813 AGTCATTTTCTCTCTAAGGCAGG + Intronic
1141486217 16:84342039-84342061 GCAGATTCTCCCTCGAAGCCCGG - Intergenic
1147769369 17:42856975-42856997 GCTCACATTCCCTCTCATCCAGG + Exonic
1152286896 17:79417859-79417881 GGTCATATTCCCTCTATGCATGG - Intronic
1152458497 17:80429484-80429506 GCTCATTTTCCCTCTAAGCCAGG + Intronic
1153109249 18:1564402-1564424 GCTCATTTTGTTTCTCAGCCTGG - Intergenic
1156584022 18:38411693-38411715 GTGCATTGTTCCTCTAAGCCCGG + Intergenic
1159593224 18:70357457-70357479 TCTCAATTACCCTATAAGCCAGG + Intergenic
1162554617 19:11379012-11379034 GGTCATTCTCCCTTTAATCCTGG + Intronic
1162633383 19:11946206-11946228 GCTCATTTACGATCTAAGACTGG - Intronic
1162786458 19:13037923-13037945 GCTTATTCTCCCTCTAAGGCTGG - Intronic
925701133 2:6639273-6639295 GCTAATTATTCCTTTAAGCCAGG - Intergenic
926060115 2:9799953-9799975 CCTCATTTACCCTCTGCGCCTGG - Intergenic
927440371 2:23111884-23111906 GCTCCTTTTCCCTCACTGCCTGG - Intergenic
928111628 2:28515158-28515180 GGTAATTTTCTTTCTAAGCCAGG - Intronic
928185127 2:29103074-29103096 GCTCATTTTACCCCTGGGCCTGG + Intronic
930380202 2:50618139-50618161 CCTCATTTTCACTGTGAGCCAGG - Intronic
931013182 2:57942784-57942806 TATCATTTTCCCTCTCATCCTGG - Intronic
932573914 2:72952378-72952400 GCTCATTTGCACTCTAAACAGGG + Intronic
932958692 2:76386646-76386668 CCTCCTTTCCCCTCCAAGCCAGG - Intergenic
933648437 2:84830613-84830635 GCTCATTTTCCTTCTCCACCAGG - Intronic
934915616 2:98298968-98298990 ACTCCCTTTCCCTCTGAGCCGGG + Intronic
938948440 2:136235631-136235653 GTTCGTTATCCCTCTAAGCTTGG + Intergenic
940259442 2:151765040-151765062 GCTCACCTTCCCTAGAAGCCTGG - Intergenic
942402781 2:175621293-175621315 GATCAATTTCCTTCTAAGCCTGG - Intergenic
944356249 2:198792065-198792087 GCTCTTTTTCCCTCAAACACAGG + Intergenic
944899230 2:204197178-204197200 GCTCAGATTCCCTCCCAGCCTGG - Intergenic
945720619 2:213414573-213414595 ACTGTTTTTCCCTCTAAGTCTGG + Intronic
946298764 2:218809218-218809240 GCTCAGTTTCCCTCAAATGCTGG + Intronic
948374248 2:237510802-237510824 GGTCATTTTACCTCAAGGCCTGG - Intronic
1170131392 20:13023889-13023911 AGTCATTTTCCCTCTAATCCAGG - Intronic
1177172614 21:17670782-17670804 TCTCCTTTTCCCTCCAAGGCAGG + Intergenic
1177227012 21:18270262-18270284 TCTCACTTTCACTCTAAGTCAGG + Intronic
1181282797 22:21731740-21731762 GCACATTTTGCATCAAAGCCTGG - Intronic
1185155480 22:49191211-49191233 GATCATTTCCCTTCTAACCCAGG - Intergenic
951078170 3:18423047-18423069 ACTCATTTTAACTCTATGCCCGG + Intronic
951388928 3:22078371-22078393 GATCATTTTCTCTGTGAGCCTGG - Intronic
953313216 3:41901067-41901089 GCTCATGTTACCACTAAGTCTGG + Intronic
955029336 3:55201224-55201246 TCCCATTTTCCCTCCAGGCCTGG + Intergenic
955554782 3:60125301-60125323 GCACAATTTCCCTCTAAGGTAGG - Intronic
956142436 3:66159354-66159376 CCTCATTTTCCCACCAAGCCTGG + Intronic
956280555 3:67551593-67551615 GCTCATTTTCCCTCCCTCCCAGG - Intronic
958552021 3:95627523-95627545 GCTCTTTTTATCTCTAAACCAGG + Intergenic
961736879 3:129007590-129007612 TCTCATCTTCCCTCTAAGGTTGG + Intronic
972640890 4:40923966-40923988 GCTCATTTTGCCTCCTATCCCGG - Intronic
978760102 4:112348195-112348217 GCTCATTTTCCAAATCAGCCTGG + Intronic
978922848 4:114205605-114205627 GCGTATTTTCCCTCTATTCCAGG + Intergenic
981646384 4:147003627-147003649 CTTCAGGTTCCCTCTAAGCCAGG + Intergenic
983272810 4:165583003-165583025 ATTCACTCTCCCTCTAAGCCAGG - Intergenic
984416416 4:179465422-179465444 ACTCATTTTTCCTCTAAGGCCGG + Intergenic
985170467 4:187143497-187143519 ACTCATTTTCACTCTATTCCTGG - Intergenic
990876257 5:60489758-60489780 GCTTGTTTTCCATCTCAGCCTGG - Intronic
993452360 5:88088033-88088055 TCTAATTTTCCCTCTAAAGCTGG + Intergenic
995502901 5:112828076-112828098 GCACAACTGCCCTCTAAGCCTGG - Intronic
995870035 5:116734783-116734805 GTACATTTTCCCACAAAGCCAGG - Intergenic
1001491740 5:172160804-172160826 TCACATTTCCCCTCTAAACCTGG - Intronic
1002190356 5:177474322-177474344 GCTCATTATCCCTCCATTCCAGG + Intronic
1003078397 6:3001800-3001822 GCTCTTTTTTCCTGTAGGCCTGG + Intronic
1004403778 6:15312744-15312766 TCTTTTTTTCCCTGTAAGCCTGG + Intronic
1013169199 6:107620848-107620870 GCTCATTTCTCCTCTTACCCGGG + Intronic
1016050910 6:139529254-139529276 GCTCATGCTCCCTCTTAGCTGGG + Intergenic
1019030717 6:169008452-169008474 CATCATCTTCCCCCTAAGCCAGG + Intergenic
1022530551 7:31064254-31064276 GCTCATTTTCTCTCTTCTCCAGG - Intronic
1022975297 7:35550649-35550671 GCACATTTTCCATCTCAACCTGG + Intergenic
1024093195 7:45964653-45964675 GCTCATACACCCTCTAGGCCAGG - Intergenic
1024837113 7:53534499-53534521 CCTCATTTTCCCTAAAACCCAGG - Intergenic
1026217075 7:68359046-68359068 GCTCATCTTCCATTGAAGCCTGG + Intergenic
1026689279 7:72538219-72538241 GCTCTTCCTGCCTCTAAGCCGGG - Intergenic
1026973160 7:74480179-74480201 GGTCATTTTCCCTGCCAGCCTGG + Intronic
1026977410 7:74506985-74507007 CCTCAGTTTCCCTCCTAGCCAGG - Intronic
1031885396 7:127240864-127240886 CCACATCTTCCCTCTAAGCAAGG + Intronic
1033824347 7:145171216-145171238 TCTTATTTTCCCTCTGATCCAGG - Intergenic
1033985539 7:147221369-147221391 GCTCAGTTTCCCTGCATGCCTGG - Intronic
1037385590 8:18336838-18336860 GCTCACTTTTCCTTTTAGCCAGG - Intergenic
1047788339 8:128176517-128176539 GCTCATTTTCCATCTCTGCTTGG + Intergenic
1052402962 9:28024275-28024297 CCTCTTTTTGCCTCTTAGCCTGG - Intronic
1052806662 9:33019696-33019718 CCCCAGTTTCCCGCTAAGCCTGG - Intronic
1055214912 9:73847656-73847678 GCTTTTTTTCCCGCTAACCCTGG + Intergenic
1056766525 9:89447676-89447698 GCCCATTTTCCCCAGAAGCCAGG + Intronic
1058007400 9:99932048-99932070 TCTCATTTTCCCCCTACGGCAGG + Intronic
1185930928 X:4202601-4202623 TCTTCTTTTCCCTTTAAGCCAGG - Intergenic
1186707715 X:12159723-12159745 ACCCATTGTCCCTGTAAGCCTGG - Intronic
1190092777 X:47454128-47454150 CCTCATTTTCCCCATAAGCAAGG - Intronic
1192414896 X:70970333-70970355 GCTCCTTTATCCTCTCAGCCTGG + Intergenic
1194040823 X:88940418-88940440 ACTCATTTATTCTCTAAGCCAGG + Intergenic
1196576848 X:117328333-117328355 TGTCATTTTGACTCTAAGCCAGG - Intergenic