ID: 1152459180

View in Genome Browser
Species Human (GRCh38)
Location 17:80432381-80432403
Sequence CCATCCAGACAGGACTCCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 202
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 187}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152459180_1152459187 -9 Left 1152459180 17:80432381-80432403 CCTGTGGAGTCCTGTCTGGATGG 0: 1
1: 0
2: 1
3: 13
4: 187
Right 1152459187 17:80432395-80432417 TCTGGATGGGAGGGAGAGCAGGG 0: 1
1: 1
2: 3
3: 51
4: 540
1152459180_1152459189 11 Left 1152459180 17:80432381-80432403 CCTGTGGAGTCCTGTCTGGATGG 0: 1
1: 0
2: 1
3: 13
4: 187
Right 1152459189 17:80432415-80432437 GGGCCGTGGACAGCCTCCAGAGG 0: 1
1: 0
2: 0
3: 18
4: 138
1152459180_1152459186 -10 Left 1152459180 17:80432381-80432403 CCTGTGGAGTCCTGTCTGGATGG 0: 1
1: 0
2: 1
3: 13
4: 187
Right 1152459186 17:80432394-80432416 GTCTGGATGGGAGGGAGAGCAGG 0: 1
1: 0
2: 1
3: 44
4: 559
1152459180_1152459188 -3 Left 1152459180 17:80432381-80432403 CCTGTGGAGTCCTGTCTGGATGG 0: 1
1: 0
2: 1
3: 13
4: 187
Right 1152459188 17:80432401-80432423 TGGGAGGGAGAGCAGGGCCGTGG 0: 1
1: 0
2: 7
3: 97
4: 965

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152459180 Original CRISPR CCATCCAGACAGGACTCCAC AGG (reversed) Intronic