ID: 1152460674

View in Genome Browser
Species Human (GRCh38)
Location 17:80440685-80440707
Sequence CCATGTCCTTCCCACGATGG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152460670_1152460674 0 Left 1152460670 17:80440662-80440684 CCTTTTCAGATTGAGAAATTTAC No data
Right 1152460674 17:80440685-80440707 CCATGTCCTTCCCACGATGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152460674 Original CRISPR CCATGTCCTTCCCACGATGG CGG Intergenic
No off target data available for this crispr