ID: 1152465782

View in Genome Browser
Species Human (GRCh38)
Location 17:80465416-80465438
Sequence CGCAAGAAGTCAAAGCCAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152465782_1152465793 26 Left 1152465782 17:80465416-80465438 CCCTCTGGCTTTGACTTCTTGCG No data
Right 1152465793 17:80465465-80465487 CCTCACTCCACCGAGCTGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152465782 Original CRISPR CGCAAGAAGTCAAAGCCAGA GGG (reversed) Intergenic
No off target data available for this crispr