ID: 1152465784

View in Genome Browser
Species Human (GRCh38)
Location 17:80465439-80465461
Sequence GAGTCTGGGCAGCGGGACAC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152465784_1152465793 3 Left 1152465784 17:80465439-80465461 CCCGTGTCCCGCTGCCCAGACTC No data
Right 1152465793 17:80465465-80465487 CCTCACTCCACCGAGCTGCAAGG No data
1152465784_1152465795 10 Left 1152465784 17:80465439-80465461 CCCGTGTCCCGCTGCCCAGACTC No data
Right 1152465795 17:80465472-80465494 CCACCGAGCTGCAAGGCCCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152465784 Original CRISPR GAGTCTGGGCAGCGGGACAC GGG (reversed) Intergenic
No off target data available for this crispr