ID: 1152465793

View in Genome Browser
Species Human (GRCh38)
Location 17:80465465-80465487
Sequence CCTCACTCCACCGAGCTGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152465784_1152465793 3 Left 1152465784 17:80465439-80465461 CCCGTGTCCCGCTGCCCAGACTC No data
Right 1152465793 17:80465465-80465487 CCTCACTCCACCGAGCTGCAAGG No data
1152465782_1152465793 26 Left 1152465782 17:80465416-80465438 CCCTCTGGCTTTGACTTCTTGCG No data
Right 1152465793 17:80465465-80465487 CCTCACTCCACCGAGCTGCAAGG No data
1152465787_1152465793 -5 Left 1152465787 17:80465447-80465469 CCGCTGCCCAGACTCCCACCTCA No data
Right 1152465793 17:80465465-80465487 CCTCACTCCACCGAGCTGCAAGG No data
1152465783_1152465793 25 Left 1152465783 17:80465417-80465439 CCTCTGGCTTTGACTTCTTGCGC No data
Right 1152465793 17:80465465-80465487 CCTCACTCCACCGAGCTGCAAGG No data
1152465785_1152465793 2 Left 1152465785 17:80465440-80465462 CCGTGTCCCGCTGCCCAGACTCC No data
Right 1152465793 17:80465465-80465487 CCTCACTCCACCGAGCTGCAAGG No data
1152465786_1152465793 -4 Left 1152465786 17:80465446-80465468 CCCGCTGCCCAGACTCCCACCTC No data
Right 1152465793 17:80465465-80465487 CCTCACTCCACCGAGCTGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152465793 Original CRISPR CCTCACTCCACCGAGCTGCA AGG Intergenic
No off target data available for this crispr