ID: 1152465795

View in Genome Browser
Species Human (GRCh38)
Location 17:80465472-80465494
Sequence CCACCGAGCTGCAAGGCCCG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152465787_1152465795 2 Left 1152465787 17:80465447-80465469 CCGCTGCCCAGACTCCCACCTCA No data
Right 1152465795 17:80465472-80465494 CCACCGAGCTGCAAGGCCCGTGG No data
1152465786_1152465795 3 Left 1152465786 17:80465446-80465468 CCCGCTGCCCAGACTCCCACCTC No data
Right 1152465795 17:80465472-80465494 CCACCGAGCTGCAAGGCCCGTGG No data
1152465785_1152465795 9 Left 1152465785 17:80465440-80465462 CCGTGTCCCGCTGCCCAGACTCC No data
Right 1152465795 17:80465472-80465494 CCACCGAGCTGCAAGGCCCGTGG No data
1152465788_1152465795 -4 Left 1152465788 17:80465453-80465475 CCCAGACTCCCACCTCACTCCAC No data
Right 1152465795 17:80465472-80465494 CCACCGAGCTGCAAGGCCCGTGG No data
1152465789_1152465795 -5 Left 1152465789 17:80465454-80465476 CCAGACTCCCACCTCACTCCACC No data
Right 1152465795 17:80465472-80465494 CCACCGAGCTGCAAGGCCCGTGG No data
1152465784_1152465795 10 Left 1152465784 17:80465439-80465461 CCCGTGTCCCGCTGCCCAGACTC No data
Right 1152465795 17:80465472-80465494 CCACCGAGCTGCAAGGCCCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152465795 Original CRISPR CCACCGAGCTGCAAGGCCCG TGG Intergenic
No off target data available for this crispr