ID: 1152465826

View in Genome Browser
Species Human (GRCh38)
Location 17:80465744-80465766
Sequence GCACGCTCACGGTCGGGCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152465826_1152465838 16 Left 1152465826 17:80465744-80465766 CCTGGGCCCGACCGTGAGCGTGC No data
Right 1152465838 17:80465783-80465805 CACCCAGCGAGAATGGCTCTGGG No data
1152465826_1152465841 24 Left 1152465826 17:80465744-80465766 CCTGGGCCCGACCGTGAGCGTGC No data
Right 1152465841 17:80465791-80465813 GAGAATGGCTCTGGGAACACAGG No data
1152465826_1152465835 9 Left 1152465826 17:80465744-80465766 CCTGGGCCCGACCGTGAGCGTGC No data
Right 1152465835 17:80465776-80465798 TGAACACCACCCAGCGAGAATGG No data
1152465826_1152465837 15 Left 1152465826 17:80465744-80465766 CCTGGGCCCGACCGTGAGCGTGC No data
Right 1152465837 17:80465782-80465804 CCACCCAGCGAGAATGGCTCTGG No data
1152465826_1152465843 30 Left 1152465826 17:80465744-80465766 CCTGGGCCCGACCGTGAGCGTGC No data
Right 1152465843 17:80465797-80465819 GGCTCTGGGAACACAGGCCAGGG No data
1152465826_1152465842 29 Left 1152465826 17:80465744-80465766 CCTGGGCCCGACCGTGAGCGTGC No data
Right 1152465842 17:80465796-80465818 TGGCTCTGGGAACACAGGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152465826 Original CRISPR GCACGCTCACGGTCGGGCCC AGG (reversed) Intergenic
No off target data available for this crispr