ID: 1152465828

View in Genome Browser
Species Human (GRCh38)
Location 17:80465751-80465773
Sequence CCAGGGTGCACGCTCACGGT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152465828_1152465837 8 Left 1152465828 17:80465751-80465773 CCGACCGTGAGCGTGCACCCTGG No data
Right 1152465837 17:80465782-80465804 CCACCCAGCGAGAATGGCTCTGG No data
1152465828_1152465841 17 Left 1152465828 17:80465751-80465773 CCGACCGTGAGCGTGCACCCTGG No data
Right 1152465841 17:80465791-80465813 GAGAATGGCTCTGGGAACACAGG No data
1152465828_1152465843 23 Left 1152465828 17:80465751-80465773 CCGACCGTGAGCGTGCACCCTGG No data
Right 1152465843 17:80465797-80465819 GGCTCTGGGAACACAGGCCAGGG No data
1152465828_1152465838 9 Left 1152465828 17:80465751-80465773 CCGACCGTGAGCGTGCACCCTGG No data
Right 1152465838 17:80465783-80465805 CACCCAGCGAGAATGGCTCTGGG No data
1152465828_1152465835 2 Left 1152465828 17:80465751-80465773 CCGACCGTGAGCGTGCACCCTGG No data
Right 1152465835 17:80465776-80465798 TGAACACCACCCAGCGAGAATGG No data
1152465828_1152465844 24 Left 1152465828 17:80465751-80465773 CCGACCGTGAGCGTGCACCCTGG No data
Right 1152465844 17:80465798-80465820 GCTCTGGGAACACAGGCCAGGGG No data
1152465828_1152465842 22 Left 1152465828 17:80465751-80465773 CCGACCGTGAGCGTGCACCCTGG No data
Right 1152465842 17:80465796-80465818 TGGCTCTGGGAACACAGGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152465828 Original CRISPR CCAGGGTGCACGCTCACGGT CGG (reversed) Intergenic
No off target data available for this crispr