ID: 1152465833

View in Genome Browser
Species Human (GRCh38)
Location 17:80465768-80465790
Sequence GCTGGGTGGTGTTCACCCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152465833_1152465847 23 Left 1152465833 17:80465768-80465790 CCCTGGGGTGAACACCACCCAGC No data
Right 1152465847 17:80465814-80465836 CCAGGGGCCTCCCGCCTGGCAGG No data
1152465833_1152465842 5 Left 1152465833 17:80465768-80465790 CCCTGGGGTGAACACCACCCAGC No data
Right 1152465842 17:80465796-80465818 TGGCTCTGGGAACACAGGCCAGG No data
1152465833_1152465844 7 Left 1152465833 17:80465768-80465790 CCCTGGGGTGAACACCACCCAGC No data
Right 1152465844 17:80465798-80465820 GCTCTGGGAACACAGGCCAGGGG No data
1152465833_1152465838 -8 Left 1152465833 17:80465768-80465790 CCCTGGGGTGAACACCACCCAGC No data
Right 1152465838 17:80465783-80465805 CACCCAGCGAGAATGGCTCTGGG No data
1152465833_1152465848 24 Left 1152465833 17:80465768-80465790 CCCTGGGGTGAACACCACCCAGC No data
Right 1152465848 17:80465815-80465837 CAGGGGCCTCCCGCCTGGCAGGG No data
1152465833_1152465843 6 Left 1152465833 17:80465768-80465790 CCCTGGGGTGAACACCACCCAGC No data
Right 1152465843 17:80465797-80465819 GGCTCTGGGAACACAGGCCAGGG No data
1152465833_1152465837 -9 Left 1152465833 17:80465768-80465790 CCCTGGGGTGAACACCACCCAGC No data
Right 1152465837 17:80465782-80465804 CCACCCAGCGAGAATGGCTCTGG No data
1152465833_1152465845 19 Left 1152465833 17:80465768-80465790 CCCTGGGGTGAACACCACCCAGC No data
Right 1152465845 17:80465810-80465832 CAGGCCAGGGGCCTCCCGCCTGG No data
1152465833_1152465841 0 Left 1152465833 17:80465768-80465790 CCCTGGGGTGAACACCACCCAGC No data
Right 1152465841 17:80465791-80465813 GAGAATGGCTCTGGGAACACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152465833 Original CRISPR GCTGGGTGGTGTTCACCCCA GGG (reversed) Intergenic
No off target data available for this crispr