ID: 1152465842

View in Genome Browser
Species Human (GRCh38)
Location 17:80465796-80465818
Sequence TGGCTCTGGGAACACAGGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152465834_1152465842 4 Left 1152465834 17:80465769-80465791 CCTGGGGTGAACACCACCCAGCG No data
Right 1152465842 17:80465796-80465818 TGGCTCTGGGAACACAGGCCAGG No data
1152465828_1152465842 22 Left 1152465828 17:80465751-80465773 CCGACCGTGAGCGTGCACCCTGG No data
Right 1152465842 17:80465796-80465818 TGGCTCTGGGAACACAGGCCAGG No data
1152465825_1152465842 30 Left 1152465825 17:80465743-80465765 CCCTGGGCCCGACCGTGAGCGTG No data
Right 1152465842 17:80465796-80465818 TGGCTCTGGGAACACAGGCCAGG No data
1152465832_1152465842 18 Left 1152465832 17:80465755-80465777 CCGTGAGCGTGCACCCTGGGGTG No data
Right 1152465842 17:80465796-80465818 TGGCTCTGGGAACACAGGCCAGG No data
1152465827_1152465842 23 Left 1152465827 17:80465750-80465772 CCCGACCGTGAGCGTGCACCCTG No data
Right 1152465842 17:80465796-80465818 TGGCTCTGGGAACACAGGCCAGG No data
1152465826_1152465842 29 Left 1152465826 17:80465744-80465766 CCTGGGCCCGACCGTGAGCGTGC No data
Right 1152465842 17:80465796-80465818 TGGCTCTGGGAACACAGGCCAGG No data
1152465833_1152465842 5 Left 1152465833 17:80465768-80465790 CCCTGGGGTGAACACCACCCAGC No data
Right 1152465842 17:80465796-80465818 TGGCTCTGGGAACACAGGCCAGG No data
1152465836_1152465842 -9 Left 1152465836 17:80465782-80465804 CCACCCAGCGAGAATGGCTCTGG No data
Right 1152465842 17:80465796-80465818 TGGCTCTGGGAACACAGGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152465842 Original CRISPR TGGCTCTGGGAACACAGGCC AGG Intergenic
No off target data available for this crispr