ID: 1152465966

View in Genome Browser
Species Human (GRCh38)
Location 17:80466358-80466380
Sequence CTCTCAGACAAGTGCAGGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152465956_1152465966 26 Left 1152465956 17:80466309-80466331 CCCAGCGTTCCCATGGCTATTTA No data
Right 1152465966 17:80466358-80466380 CTCTCAGACAAGTGCAGGGAAGG No data
1152465963_1152465966 1 Left 1152465963 17:80466334-80466356 CCTTTGTAGGGACACTCTCAGAC No data
Right 1152465966 17:80466358-80466380 CTCTCAGACAAGTGCAGGGAAGG No data
1152465957_1152465966 25 Left 1152465957 17:80466310-80466332 CCAGCGTTCCCATGGCTATTTAT No data
Right 1152465966 17:80466358-80466380 CTCTCAGACAAGTGCAGGGAAGG No data
1152465959_1152465966 16 Left 1152465959 17:80466319-80466341 CCATGGCTATTTATCCCTTTGTA No data
Right 1152465966 17:80466358-80466380 CTCTCAGACAAGTGCAGGGAAGG No data
1152465962_1152465966 2 Left 1152465962 17:80466333-80466355 CCCTTTGTAGGGACACTCTCAGA No data
Right 1152465966 17:80466358-80466380 CTCTCAGACAAGTGCAGGGAAGG No data
1152465958_1152465966 17 Left 1152465958 17:80466318-80466340 CCCATGGCTATTTATCCCTTTGT No data
Right 1152465966 17:80466358-80466380 CTCTCAGACAAGTGCAGGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152465966 Original CRISPR CTCTCAGACAAGTGCAGGGA AGG Intergenic
No off target data available for this crispr