ID: 1152466177

View in Genome Browser
Species Human (GRCh38)
Location 17:80467868-80467890
Sequence CTGTGTTATCAAAAGCAAGA AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 338
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 319}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152466177 Original CRISPR CTGTGTTATCAAAAGCAAGA AGG Exonic
902247729 1:15132488-15132510 CAGTGTTATCAAAACCAAGGTGG - Intergenic
902866172 1:19281335-19281357 CTGTGTTCTCAAAAAAAAGCTGG + Intergenic
902954814 1:19918343-19918365 CTGTGCTAGCAAAAGGAAGGAGG - Intergenic
903331541 1:22599555-22599577 CTGTGACAACAAAAGAAAGAAGG + Intronic
904057302 1:27679912-27679934 CTGTAAAATCAAAAGCAAGTTGG + Intergenic
904453091 1:30629096-30629118 CTGTGTTCTCAGGAGCAGGAAGG - Intergenic
905476961 1:38235741-38235763 CTGTGTTGGGAAAAGAAAGAAGG - Intergenic
906860752 1:49356638-49356660 CTTGGTTATCAAAAATAAGAAGG + Intronic
907680410 1:56557977-56557999 CAGAGTTCTCAAAAGCAAGGGGG - Intronic
908467288 1:64409173-64409195 CTCTGTTATCAAAAGAAAGGTGG + Intergenic
908606593 1:65804475-65804497 CTGTCTTATGAAAATTAAGAGGG + Intronic
908810952 1:67981942-67981964 CTGGCTTATCAAATGCAATAAGG - Intergenic
910554085 1:88510932-88510954 CTGTTTTATTAAAAGCATGGAGG + Intergenic
910965725 1:92806203-92806225 CTCTGTTATTACAAGAAAGAAGG + Intergenic
917106004 1:171492698-171492720 GTTTCTTATTAAAAGCAAGAGGG + Intronic
917253268 1:173086451-173086473 CTGTGTCCTCACAAGCAAGAAGG + Intergenic
917513824 1:175690454-175690476 CTGAGTCATAAAGAGCAAGAAGG + Intronic
918162286 1:181912560-181912582 CTCTGTTCTAAAAATCAAGATGG - Intergenic
919371840 1:196738420-196738442 CTGTAAAATCAAAAGCAAGTTGG + Intronic
920044944 1:203127104-203127126 CTGTGCTATGAAGAGGAAGAAGG + Exonic
920728531 1:208460983-208461005 CTGTGCTATCAAGAGCAATCAGG - Intergenic
920766549 1:208839172-208839194 CTGTGTCATCATTAGGAAGATGG + Intergenic
921345020 1:214174720-214174742 CTGTGTTATGAAAAGCACTTTGG - Intergenic
921507828 1:215994892-215994914 CTGAGTTATCAAAGGAAAAATGG + Intronic
922547640 1:226470608-226470630 CTGTATATTCAAAATCAAGATGG - Intergenic
922667206 1:227480779-227480801 CAGTGTTTTCAAAAACAAAATGG - Intergenic
922883363 1:228999314-228999336 TTCTGTTATCAAGAGCAAGAGGG + Intergenic
924657945 1:245990438-245990460 CTGTGTGACCAAAAGGAAGTAGG - Intronic
1063225179 10:4008847-4008869 CTGTGTTAGTTAAAGGAAGATGG - Intergenic
1064700165 10:18010491-18010513 ATTTCTTAACAAAAGCAAGAAGG + Intronic
1065168435 10:23004911-23004933 CTGTTTTAAGAAAACCAAGAGGG + Intronic
1066270412 10:33817100-33817122 TCTTGTTACCAAAAGCAAGAAGG - Intergenic
1067133413 10:43586778-43586800 CTGTGTTAGCAGAGACAAGAAGG - Intergenic
1067542514 10:47166215-47166237 GTGTGTGAGCAAAAGCCAGAAGG + Intergenic
1068065003 10:52119844-52119866 CTGTGTTATCCAATGGCAGAAGG + Intronic
1068439522 10:57032888-57032910 CTGTAAAATCAAAAGCAAGATGG - Intergenic
1069227812 10:65966183-65966205 CTATGTTATAAAAAGAAATAGGG + Intronic
1069945223 10:71981084-71981106 CTGTTTTTTCAAAGGGAAGAAGG + Intronic
1071917675 10:90313876-90313898 CTGTGATATTAAAAGACAGAAGG - Intergenic
1071942111 10:90601496-90601518 CTGTAAAATCAAAAGCAAGTTGG - Intergenic
1074480944 10:113820136-113820158 CTGTGTTCCAAACAGCAAGACGG + Intergenic
1074909475 10:117894662-117894684 CTTTGTTATCCAAAAGAAGAAGG - Intergenic
1076136610 10:128049507-128049529 CTGTGGGATCAAAAGAAACATGG - Intronic
1076593669 10:131609761-131609783 CTGTGTATTCATAAGCAATAGGG + Intergenic
1076927645 10:133500986-133501008 CTCAGCTATCAAAAGCAAGGTGG - Intergenic
1077520652 11:3031914-3031936 TTGTGTTTCCAATAGCAAGAAGG + Intronic
1078950207 11:16123307-16123329 CAGTTTCATCACAAGCAAGAAGG + Intronic
1079554550 11:21742403-21742425 GTGTGTTAACAAAAGCAAAGGGG - Intergenic
1079997748 11:27313540-27313562 CTGAGTTTTAAAAAGCCAGAGGG + Intergenic
1080794533 11:35551258-35551280 CTGAATGATCAGAAGCAAGATGG + Intergenic
1082203640 11:49404706-49404728 CTGTTTTATTAAAATAAAGAAGG + Intergenic
1083288317 11:61675234-61675256 CGCTGTTTTCAGAAGCAAGAAGG + Intergenic
1085621637 11:78042125-78042147 CTGTGACACCAGAAGCAAGATGG - Intronic
1085799149 11:79571992-79572014 CTGTGTGATCTCAAGCAAGTTGG - Intergenic
1086651448 11:89295726-89295748 CTGTTTTATTAAAATAAAGAAGG - Exonic
1087255197 11:95945450-95945472 CTGTAAAATCAAAAGCAAGTTGG - Intergenic
1088225713 11:107617461-107617483 CTTCCTTATCAAAAGGAAGAAGG + Intronic
1089405250 11:118192264-118192286 CTGTGAAATCAAAAGCAAGCTGG - Intergenic
1090568713 11:128024299-128024321 TTGTTTTATCAAAGGGAAGAAGG + Intergenic
1091330905 11:134730194-134730216 CTGTGTTTGCACAAGCAACATGG - Intergenic
1091333769 11:134751593-134751615 TTGTGAGATCAGAAGCAAGATGG - Intergenic
1091773918 12:3172022-3172044 CTGAGTTATCACAACCAGGATGG - Intronic
1093722769 12:22463508-22463530 CTGTGTTATCACAGGGCAGAAGG - Intronic
1093878647 12:24378823-24378845 CTGTCTTTTTAAAAGCAACAGGG - Intergenic
1093916986 12:24814943-24814965 CTTTGTTTTCAAAAGCACAAAGG - Intronic
1094263715 12:28530190-28530212 CTATGTCATAAAAAGCAATAAGG + Intronic
1095173945 12:39068427-39068449 CTGAGTTATAAAAAAAAAGACGG - Intergenic
1098628267 12:72699316-72699338 CTGTAAAATCAAAAGCAAGTTGG + Intergenic
1099635292 12:85204754-85204776 CTGTAAAATCAAAAGCAAGCTGG - Intronic
1100205585 12:92345623-92345645 CTGTAACATCAAAAGCAAGCTGG - Intergenic
1100427600 12:94501733-94501755 CTGTAAAATCAAAAGCAAGTTGG + Intergenic
1103793895 12:123490324-123490346 CTGGGTTATCAAGGGCTAGATGG - Intronic
1104391181 12:128391716-128391738 CTGTGTGACCTAAAGCAAGGAGG - Intronic
1104993384 12:132639547-132639569 CTGTGTGTTCTAAAGCAGGACGG + Intronic
1106136001 13:26974248-26974270 CTGATTTATCAAAACCAGGAAGG - Intergenic
1106718876 13:32418919-32418941 CTGTAAAATCAAAAGCAAGTTGG - Intronic
1108321948 13:49298308-49298330 CTGTGTCATCAAAAGGCAGGGGG - Intergenic
1109837869 13:67882364-67882386 CTCTACTTTCAAAAGCAAGAGGG + Intergenic
1109870103 13:68322604-68322626 CTGTAAAATCAAAAGCAAGTTGG + Intergenic
1110066893 13:71119487-71119509 CTGTTTAATTAAAAGAAAGAAGG - Intergenic
1110454774 13:75679092-75679114 CTGTGTCATGAAAAGAAAGGGGG - Intronic
1110689455 13:78415295-78415317 CTGTGTTTTCAAAAGAAACATGG + Intergenic
1111811539 13:93097989-93098011 CAGTGTTAGCCAAAACAAGAAGG + Intergenic
1112245008 13:97725309-97725331 CAGTGTTATTAAAGGGAAGAAGG + Intergenic
1115023144 14:28707571-28707593 CAGTGGGACCAAAAGCAAGAAGG + Intergenic
1115036174 14:28859076-28859098 CTTTTTTAACAAAAGGAAGAGGG - Intergenic
1115780684 14:36764936-36764958 ATCTGTTCTTAAAAGCAAGATGG - Intronic
1116054884 14:39851233-39851255 CTGTGTTTTGAAAAGGAAAATGG - Intergenic
1117146685 14:52842951-52842973 CTGTGTTATCACTAGGAAGCTGG + Intergenic
1117298392 14:54398910-54398932 CTGTGATATCAAAATAGAGATGG - Intronic
1117335511 14:54754205-54754227 CTGACTTATCAAAGGCTAGATGG - Intronic
1118046413 14:61975961-61975983 CTGTAAAATCAAAAGCAAGTTGG + Intergenic
1118210048 14:63757551-63757573 CTGTGTAAGCAACAGAAAGAGGG - Intergenic
1118619043 14:67597935-67597957 CTGTGAACTCAAAAACAAGAAGG + Intronic
1120481176 14:85051729-85051751 CTGTGTTATCAAGACAGAGAGGG - Intergenic
1121711987 14:96045358-96045380 CTGTGTGCACAAAGGCAAGAAGG + Intronic
1122123595 14:99567460-99567482 CTGTGTTCTCACCAGCAGGAGGG + Intronic
1122239616 14:100353924-100353946 CTGTGTTTTCAGATGCACGATGG - Intronic
1122495785 14:102153784-102153806 CTGTGATCTAAACAGCAAGAAGG - Intronic
1127596797 15:60492094-60492116 CTTTATTATCAAAAACAACATGG + Intronic
1129554298 15:76489021-76489043 CTTTCTTATAAAAGGCAAGATGG - Intronic
1130889030 15:88117712-88117734 CTCTGTTACCACAAGCCAGAGGG - Intronic
1133625168 16:7564221-7564243 CTGTGTTCTCAGATGGAAGAGGG - Intronic
1133830176 16:9315693-9315715 CTGTGACATCAAAAGGGAGACGG + Intergenic
1136674693 16:31892576-31892598 CTGTAAAATCAAAAGCAAGTTGG + Intronic
1138660387 16:58513084-58513106 CAGTGTTATCTACAGTAAGAGGG - Exonic
1139198777 16:64951010-64951032 CTGTGTTATCTGCAGAAAGAGGG + Exonic
1139307862 16:66003205-66003227 CTGTGGCATCCATAGCAAGAAGG - Intergenic
1139584722 16:67894446-67894468 CTGCGTTATCTAAAGCACAAGGG - Intronic
1140958642 16:79891457-79891479 GAGTGTTAGCAATAGCAAGATGG - Intergenic
1142392170 16:89808793-89808815 CTGTTTTATCAAATGGGAGAGGG - Intronic
1145928142 17:28663094-28663116 CTGTAATATCAAAAGTAACAAGG + Intronic
1149076081 17:52597156-52597178 CTCTGATATCAGGAGCAAGATGG - Intergenic
1152466177 17:80467868-80467890 CTGTGTTATCAAAAGCAAGAAGG + Exonic
1152768471 17:82153476-82153498 CTGTGGGGTCAACAGCAAGAAGG - Intronic
1153925823 18:9833953-9833975 CTGTCTCATAAAAAGCATGAAGG - Intronic
1155253253 18:23971111-23971133 TTGTGTTATCAAAACTAAGCAGG - Intergenic
1156950687 18:42893421-42893443 CTGTGTCCTCAAAAGGCAGAAGG + Intronic
1158279520 18:55806950-55806972 CAGTGCTATCAACAGAAAGAAGG - Intergenic
1158822726 18:61179519-61179541 CTGTAAAATCAAAAGCAAGTTGG - Intergenic
1159507755 18:69358441-69358463 CTGTGTCATCAAAAAAAGGAAGG - Intergenic
1159641900 18:70873239-70873261 CTGTAATATCACAACCAAGATGG + Intergenic
1159773165 18:72572713-72572735 TTATGTCATCAAAAGCAAGCTGG - Intronic
1162058451 19:8080136-8080158 CTTTATTAACAAAAGCAAGCAGG + Intronic
1162870173 19:13580537-13580559 CTGTGTTTTCACAAGCCCGAAGG + Intronic
1164262323 19:23578935-23578957 TTGTGATATCAAAAACAGGAAGG + Intronic
1164438530 19:28253304-28253326 CTGTTTTACCAAAAGAAGGATGG - Intergenic
925463202 2:4082954-4082976 CTGTGTTATAAAATACAAAACGG + Intergenic
925853048 2:8102199-8102221 CTGTTTTCTCAATAGCAAAATGG - Intergenic
926863457 2:17333789-17333811 CTGTGTTATCACATGGCAGAAGG - Intergenic
927990465 2:27443382-27443404 CTGTATCCTGAAAAGCAAGAAGG - Exonic
928923575 2:36553066-36553088 CTGAGTTTCCAATAGCAAGAAGG + Exonic
929479656 2:42292861-42292883 CTGTCTTATCACTAGCATGATGG + Intronic
929906884 2:46054314-46054336 CTCAGTTATCAAATGCAAGTGGG - Intronic
931831453 2:66055920-66055942 CTGTGTTCTCACATGGAAGAAGG - Intergenic
931897753 2:66752060-66752082 CGGTGTTAACAAAAGAAAGGAGG + Intergenic
931908608 2:66869914-66869936 CAGTGTTATGAATAGGAAGAAGG + Intergenic
934676099 2:96250689-96250711 CTGTGTGATCAAATGTATGAAGG + Exonic
934960585 2:98668986-98669008 CTGTAAAATCAAAAGCAAGCTGG - Intronic
936401759 2:112169936-112169958 CTGTTTTAAGAAAAGGAAGAAGG + Intronic
937496565 2:122426410-122426432 CTGTGTCCTCACAGGCAAGAAGG - Intergenic
937800706 2:126077503-126077525 CTGTAAAATCAAAAGCAAGTTGG - Intergenic
938020945 2:127905428-127905450 CTGTGTGAGGAACAGCAAGAAGG - Intergenic
938284624 2:130100169-130100191 CTGGGATATCAAAAACATGATGG + Intronic
938335262 2:130488728-130488750 CTGGGATATCAAAAACATGATGG + Intronic
938354564 2:130631938-130631960 CTGAGATATCAAAAACATGATGG - Intronic
938430983 2:131238723-131238745 CTGGGATATCAAAAACATGATGG - Intronic
939667195 2:144966089-144966111 CTGTAAAATCAAAAGCAAGTTGG - Intergenic
939785743 2:146509569-146509591 CTGTGTAATGAAAAACAAGGGGG + Intergenic
940790682 2:158027247-158027269 CTGTAAAATCAAAAGCAAGCTGG + Intronic
940822104 2:158367215-158367237 TTGTGTTATAAAAAGGAAAAAGG - Intronic
941734237 2:168955662-168955684 CTGTGTTTTGAAATGTAAGAAGG - Intronic
943491406 2:188559551-188559573 CTGTAAAATCAAAAGCAAGTGGG - Intronic
944981413 2:205124947-205124969 TTGGGATACCAAAAGCAAGAGGG + Intronic
945997346 2:216449071-216449093 CCATGTTATGAAGAGCAAGAAGG - Intronic
946732153 2:222720282-222720304 CTGTAAAATCAAAAGCAAGTTGG + Intergenic
946850856 2:223905674-223905696 GTGTGTTATCAAAAAAAAAATGG + Intronic
947318247 2:228887522-228887544 GAGTTTTATCAAAACCAAGAAGG - Intronic
948539578 2:238679612-238679634 TTGTCATACCAAAAGCAAGAAGG - Intergenic
948913068 2:241015052-241015074 CTGTCTTGTGAAAAGCAAGGTGG - Intronic
1169079972 20:2792032-2792054 CAGTGTCAACAAAGGCAAGAGGG - Intergenic
1170332048 20:15223906-15223928 CTGTGTTATAAAAGGCAACATGG + Intronic
1172045588 20:32077825-32077847 CTGTGGTATAAAAAGGAAGGAGG - Intronic
1174852146 20:54005931-54005953 GGGGGTTATGAAAAGCAAGATGG + Intronic
1175954408 20:62601261-62601283 CTTTATTTTCAACAGCAAGAAGG - Intergenic
1176899444 21:14421084-14421106 CTGAGCTACCAAAAGCTAGAGGG - Intergenic
1177881592 21:26701839-26701861 CTGTAAAATCAAAAGCAAGTTGG + Intergenic
1178002599 21:28179772-28179794 CCATGTTATCACAAGCAATAGGG + Intergenic
1178328337 21:31663586-31663608 CTGTGTCCTCAAAAGGGAGATGG - Intronic
1179409899 21:41154379-41154401 CTGTGGTCTGAACAGCAAGAGGG + Intergenic
1179439706 21:41384391-41384413 CAGTTTCATCAAAAGCAAGTTGG + Intronic
1181118333 22:20648277-20648299 CTGAGTTCTCAAAGGCAAGATGG + Intergenic
1182182450 22:28363904-28363926 CTGTAAAATCAAAAGCAAGTTGG - Intronic
1183190178 22:36317267-36317289 CTCTGTAATTAAAAGCCAGAAGG + Intronic
1185201263 22:49506987-49507009 CTGTCTCATAAAAAGGAAGAAGG + Intronic
949146363 3:705395-705417 CTGAGTTAGAAAATGCAAGATGG - Intergenic
950839348 3:15951994-15952016 CTGTGTTATCCAAATCCAAATGG + Intergenic
950840914 3:15967539-15967561 CTGGGTTAGATAAAGCAAGAAGG + Intergenic
951120438 3:18920698-18920720 CTGTGTTTTCAGAAGGAGGAAGG - Intergenic
952172764 3:30827019-30827041 ATGTATTTTCCAAAGCAAGAAGG + Intronic
953961915 3:47273111-47273133 CTGAAAGATCAAAAGCAAGAAGG - Intronic
955714213 3:61811401-61811423 CTGTGGGACCAAAAGCAAGAGGG - Intronic
956546281 3:70407399-70407421 CTGTGAAATTAAAAGCAAGCTGG + Intergenic
957374395 3:79337087-79337109 CTGTAAAATCAAAAGCAAGCTGG - Intronic
957477310 3:80741146-80741168 CTTTGACATCAAAAGGAAGAGGG + Intergenic
957636045 3:82787211-82787233 CTGTCCTATCCAAAGCAACATGG + Intergenic
959400581 3:105896846-105896868 CCCTATTATTAAAAGCAAGATGG + Intergenic
959545313 3:107588994-107589016 CTGTGTTGTCAAAATTAAGGGGG + Intronic
959804925 3:110540093-110540115 TTATGATATCAGAAGCAAGAAGG + Intergenic
959952539 3:112195762-112195784 CTGTGATATCAACAGCTGGAAGG - Intronic
961124709 3:124406569-124406591 CTGGGTTATCAATTGCAAAATGG - Intronic
962322590 3:134404247-134404269 CTGTGTTGAGAAAAGCATGAAGG + Intergenic
964508633 3:157425643-157425665 CTGTAAAATCAAAAGCAAGTTGG - Intronic
964706018 3:159619417-159619439 CTCTGTTTTCATAAGCAAGGGGG - Intronic
964937526 3:162109999-162110021 CTATTGTATCAAAAGAAAGAAGG + Intergenic
965850658 3:173018884-173018906 CTGGGTTGTCACAGGCAAGAAGG + Intronic
965887601 3:173466956-173466978 ATGTGTTATAAAAATAAAGAAGG - Intronic
966109935 3:176388191-176388213 CTGTTTTATCTAAAGCAAAATGG + Intergenic
966626004 3:182017788-182017810 CTTTGGTATCCAAAGAAAGAAGG + Intergenic
967452564 3:189643486-189643508 CTGAGTTATCAACAGAAATAGGG - Intronic
967598478 3:191356326-191356348 CTGTCTTCTCAGAAGCAAAATGG - Intronic
967757534 3:193186907-193186929 CTGGGTTCTCAAAAGAAAGTCGG - Intergenic
969121833 4:4916588-4916610 CTGTAAAATCAAAAGCAAGTTGG + Intergenic
970061615 4:12039980-12040002 CTGTAAAATCAAAAGCAAGTTGG - Intergenic
970483099 4:16497539-16497561 CTGTAAAATCAAAAGCAAGTTGG - Intergenic
970721746 4:18996761-18996783 CTGTAAAATCAAAAGCAAGTTGG + Intergenic
971681406 4:29706129-29706151 CTGTAAAATCAAAAGCAAGTTGG + Intergenic
972137445 4:35909165-35909187 CTGTAAGATCAAAAGCAAGTTGG - Intergenic
972314814 4:37916532-37916554 CTGTCTTTTCACAACCAAGATGG - Intronic
972406406 4:38750866-38750888 CTATGTTATAAAAAGCAATTAGG - Intergenic
976895160 4:90100398-90100420 CTGTGAAATTAGAAGCAAGATGG + Intergenic
978534536 4:109747184-109747206 CTCTGTTTTAAAAAGAAAGAAGG - Intronic
979035729 4:115714411-115714433 TCGTGTTATAAACAGCAAGAAGG + Intergenic
979978478 4:127225423-127225445 CTGTGTTCTGAAAAGCAAGTAGG - Intergenic
981611350 4:146597128-146597150 CTGTAAAATCAAAAGCAAGTTGG + Intergenic
983351262 4:166593128-166593150 CTGTGTTACCAAAAGCTTTATGG + Intergenic
983826526 4:172268789-172268811 CTGTGTTCTCACATGGAAGAGGG - Intronic
984185055 4:176533552-176533574 CTCTATCACCAAAAGCAAGATGG + Intergenic
985220411 4:187697601-187697623 CTGTAAAATCAAAAGCAAGTTGG - Intergenic
986626389 5:9726845-9726867 CTTTCTTATCAAAAGGAAAATGG - Intergenic
988010624 5:25477684-25477706 CTGAAATATCAAATGCAAGAAGG - Intergenic
988136602 5:27179792-27179814 CTTGTTTATCAAAAGAAAGAAGG - Intergenic
989149699 5:38286759-38286781 CTGTGTAAACTATAGCAAGATGG - Intronic
991536016 5:67669860-67669882 CTGTAAAATCAAAAGCAAGTTGG - Intergenic
993967087 5:94371896-94371918 CTGTAAAATCAAAAGCAAGTTGG + Intronic
994889468 5:105612224-105612246 CTGTTTTGTGAAAAGCAATATGG + Intergenic
994977283 5:106825921-106825943 CTGTGTTATATGAAACAAGATGG - Intergenic
996071578 5:119137320-119137342 CTGTAAAATCAAAAGCAAGTTGG - Intronic
996395287 5:123007367-123007389 ATGTTTTCTCAAAAGGAAGATGG - Intronic
997890882 5:137675744-137675766 CTATGATCTCAAGAGCAAGATGG + Intronic
998354563 5:141524228-141524250 CTCTGTTATAAAGAACAAGATGG + Exonic
998606596 5:143641734-143641756 CTGTGAAATCAAAACCGAGAGGG - Intergenic
998772154 5:145557949-145557971 CTGTGAGAACAAAAGTAAGATGG + Intronic
998961374 5:147490342-147490364 TTTTGTTATTATAAGCAAGAAGG - Intronic
999535360 5:152510808-152510830 CCATGTTATGACAAGCAAGAAGG + Intergenic
999902414 5:156099092-156099114 CTCTTTTATCAAAAAGAAGAAGG - Intronic
1001590057 5:172858933-172858955 CTGTGTGGTCAAAAGCTACAAGG + Intronic
1002686918 5:181020075-181020097 CTTTGTTATGAAAAGCAACATGG - Intergenic
1002786686 6:406055-406077 CTTTGTTTTTAAAATCAAGAAGG - Intronic
1003015777 6:2466499-2466521 CTGTGTTTTAAAAAGTAACAGGG - Intergenic
1004232691 6:13847303-13847325 CTGTGAGATTAGAAGCAAGATGG - Intergenic
1004773466 6:18813910-18813932 CTGTGCTTTCAACAGCAAAATGG + Intergenic
1005103546 6:22199320-22199342 CTGTGATGTTAGAAGCAAGATGG + Intergenic
1005245186 6:23876065-23876087 AAGTGTTATGAAAAGCAGGATGG + Intergenic
1008103412 6:47416897-47416919 CTGTGAAGCCAAAAGCAAGATGG + Intergenic
1008756222 6:54797854-54797876 CTGTAAAATCAAAAGCAAGCTGG - Intergenic
1010504409 6:76639616-76639638 CTATGTTTTAAAAAGCAAAATGG - Intergenic
1012881098 6:104791325-104791347 CTGTCTAATCAACAGCAAGTTGG - Intronic
1013358685 6:109372566-109372588 CTGTTTAATCAAGAGCAGGATGG - Intronic
1013582354 6:111548780-111548802 CTGTGGGATAGAAAGCAAGAAGG + Intergenic
1013688172 6:112609854-112609876 CTGTTAAATCAAAAGCAAGTTGG - Intergenic
1013921444 6:115409349-115409371 CTGTGAATTCAAGAGCAAGATGG + Intergenic
1014861324 6:126470930-126470952 CTGTAAAATCAAAAGCAAGTTGG - Intergenic
1015118167 6:129671965-129671987 CTGTGTTCTCAGAGGCAAAATGG - Intronic
1015775205 6:136806969-136806991 CAGTGGTATCAAAAGGAAAAGGG - Intergenic
1016664779 6:146625242-146625264 CTCTGTTATTAAATTCAAGAAGG + Intronic
1017181785 6:151560844-151560866 GTGTGTTATTACATGCAAGATGG + Intronic
1018625795 6:165777534-165777556 CTGAGTTATCCTAAGCAAGATGG + Intronic
1022962516 7:35441973-35441995 CTGTGTTATTAAAAGCCAAAAGG - Intergenic
1023679049 7:42664838-42664860 CTGAGTTATGAATAGAAAGAAGG + Intergenic
1025796804 7:64745573-64745595 CTTTGTTATCAAAAATAATATGG + Intergenic
1026128927 7:67604603-67604625 CTGTGAGGTTAAAAGCAAGATGG - Intergenic
1026261530 7:68759707-68759729 CTGTGTGATGCAGAGCAAGAAGG - Intergenic
1026541981 7:71287707-71287729 CTGTGTTCTTATAATCAAGAAGG + Intronic
1027739541 7:81983128-81983150 CTGTGTTTTCATATGCAAGCTGG - Intronic
1031814110 7:126411212-126411234 CTGTGTTTTAAACAGCAGGAAGG + Intergenic
1032275056 7:130447131-130447153 CTGAGTGCTCAAAAGAAAGATGG + Intergenic
1032304979 7:130724231-130724253 AAGTGTTAATAAAAGCAAGAAGG - Intergenic
1033233262 7:139618630-139618652 CTGTCATATCACCAGCAAGATGG + Intronic
1033714535 7:143986036-143986058 GTGTGTCAACAAAAGCCAGAAGG - Intergenic
1033810612 7:145006654-145006676 CTGAGTTACAAAAAACAAGACGG - Intergenic
1033837662 7:145335300-145335322 CTGTAAAATCAAAAGCAAGTTGG + Intergenic
1033871847 7:145763219-145763241 CTGTAAAATCAAAAGCAAGTTGG - Intergenic
1033919197 7:146367687-146367709 CTGTGTTAGCAAAGGCAAAAAGG - Intronic
1034175078 7:149093360-149093382 CTGTCTTAACAAAAGGAAGCAGG + Intergenic
1034997215 7:155585300-155585322 CTGTGTTATCAGAAGCACACAGG + Intergenic
1035866988 8:3094662-3094684 CTGTGTTTTAAAAAGCATTATGG + Intronic
1037292085 8:17361495-17361517 CTGTGTTCTAAAAGGAAAGAAGG - Intronic
1038820216 8:30945019-30945041 GTGTGCTGTCAAAAGCAAAAGGG + Intergenic
1040551113 8:48438412-48438434 CTGTGTTTTGAAAAGCAAAATGG - Intergenic
1041618588 8:59937321-59937343 CTTTGTAATAAAAAGTAAGAAGG - Intergenic
1041706729 8:60854151-60854173 CTGTGTCATCATCTGCAAGATGG + Intronic
1041716933 8:60941015-60941037 CTGTGTTCTCACATGGAAGAAGG + Intergenic
1041860949 8:62511651-62511673 CTGTGGTAGAGAAAGCAAGAGGG - Intronic
1042525576 8:69761454-69761476 CAGTGTAATCAAAGGAAAGACGG - Intronic
1043225363 8:77721235-77721257 CTATGTTCTCATAAGCAAAAAGG + Intergenic
1043357423 8:79429303-79429325 CTGTGTCATCACAAGGCAGAAGG - Intergenic
1043478346 8:80626880-80626902 CTATGGTATCAAGAGCGAGAGGG - Intergenic
1044540406 8:93402736-93402758 CTCTGTTATTTAAAGGAAGAGGG + Intergenic
1044954678 8:97467727-97467749 TTCTGTTATCAAAAGCATGCAGG - Intergenic
1045498336 8:102726914-102726936 CTGTGTTTTCAAATGCAACTTGG - Intergenic
1045565285 8:103308446-103308468 CTATGTTATCAGTAGAAAGATGG - Intronic
1046703140 8:117423527-117423549 CTGTAAAATCAAAAGCAAGTTGG + Intergenic
1047228822 8:122978764-122978786 ATATGTTGTGAAAAGCAAGACGG - Intergenic
1047393239 8:124471317-124471339 CTGGGTTATCTTAAGCAAAAAGG - Intergenic
1047798696 8:128286157-128286179 CTGTGTTTTCAAAAGCATGGTGG + Intergenic
1048919268 8:139213225-139213247 CTGTGTTATGAGATGAAAGAAGG - Intergenic
1051015676 9:12473247-12473269 TTTTGTTAACAAAAGCAAGTTGG - Intergenic
1051163185 9:14231870-14231892 ATGGGTTAACAAAAGCAAGGAGG + Intronic
1051957639 9:22715153-22715175 CTGTTTTTTTAAAATCAAGAAGG + Intergenic
1052161152 9:25261591-25261613 CAGTGTTATCAAATGGAGGATGG - Intergenic
1052489167 9:29141266-29141288 TTGTGTTATCAATAACATGAAGG + Intergenic
1052515284 9:29472335-29472357 CTGTATTCTCCAAAGCAAGCAGG + Intergenic
1052515329 9:29472599-29472621 CTGTGTTATCCACAGCCAGCAGG + Intergenic
1052767869 9:32660086-32660108 CTGTGAAATCAAAAGCAGGTTGG + Intergenic
1053608468 9:39684202-39684224 CTGTTTTATTAAAAGCATAAAGG + Intergenic
1053866312 9:42440566-42440588 CTGTTTTATTAAAAGCATAAAGG + Intergenic
1054245061 9:62658207-62658229 CTGTTTTATTAAAAGCATAAAGG - Intergenic
1054559190 9:66692738-66692760 CTGTTTTATTAAAAGCATAAAGG - Intergenic
1055023495 9:71694750-71694772 CTGTGTTAAGAATATCAAGATGG - Intronic
1057134295 9:92676210-92676232 CTGTGTTTAGAAATGCAAGATGG + Intergenic
1057219207 9:93246905-93246927 CTCTTTTATCAGAAGAAAGAAGG + Intronic
1057256038 9:93547943-93547965 CTCTGTTATAGAAAGCCAGATGG + Intronic
1057515568 9:95717533-95717555 TTGTGTTATCAGAAAGAAGATGG + Intergenic
1057768277 9:97942824-97942846 CTGTTTAGTCAAAAACAAGACGG + Intronic
1058624475 9:106920392-106920414 ATGTGTACACAAAAGCAAGATGG + Intronic
1058650592 9:107172212-107172234 ATGTGTTTTCATAAACAAGAGGG + Intergenic
1059212477 9:112526646-112526668 CTGTGTTATCACATGTCAGAAGG + Intronic
1061094727 9:128449253-128449275 CTGTGTTATAAACAACAGGAGGG - Intergenic
1061160955 9:128893453-128893475 CTGTGTCCTCAACTGCAAGATGG - Intronic
1185913034 X:4003352-4003374 CTGTGTTCTTAAATGGAAGAAGG - Intergenic
1186107327 X:6221757-6221779 CTGTGGTCTCAAAAGCATGGGGG - Intronic
1187070335 X:15881249-15881271 CTGTGTTTTCCAAAGACAGAAGG - Intergenic
1187556955 X:20361237-20361259 ATGTGTTATCTAAGGCAAGGGGG + Intergenic
1188465304 X:30472818-30472840 CTGTGTTATGAATAGGAAGTGGG - Intergenic
1190258422 X:48782718-48782740 CTGTGGTGTCAAAAGCACCAAGG - Intergenic
1191078836 X:56487368-56487390 TTGTGTTCTCCAAAGCAAGCAGG + Intergenic
1192496479 X:71619699-71619721 CAGTGTTATCCAAAACAACATGG - Intergenic
1193236539 X:79114030-79114052 CTGTAAAATCAAAAGCAAGCTGG + Intergenic
1193535117 X:82705356-82705378 CTTTGTTATCTCAAGCAAGTAGG - Intergenic
1193543130 X:82795480-82795502 CTGTAAAATCAAAAGCAAGTTGG - Intergenic
1193630420 X:83879510-83879532 GTGTGTTTTCACAAGCAAGTTGG - Intronic
1194639265 X:96383102-96383124 CTGAATTAACAAAAGGAAGAAGG + Intergenic
1194939441 X:99992085-99992107 CTGTTTAATCATAAGCAAGCAGG + Intergenic
1196647149 X:118130378-118130400 TTTTGATATCAAAAGCAAGCAGG + Intergenic
1197419073 X:126215419-126215441 TGGTGTTATCAAGGGCAAGAGGG + Intergenic
1198585693 X:138118280-138118302 CTGTGTTAGCAAAAATATGAAGG - Intergenic
1201578123 Y:15482066-15482088 TTGTGACATCAGAAGCAAGATGG + Intergenic