ID: 1152466656

View in Genome Browser
Species Human (GRCh38)
Location 17:80470459-80470481
Sequence TGTGCGTGCGTGGCTGGGGG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1392
Summary {0: 1, 1: 0, 2: 3, 3: 125, 4: 1263}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152466656 Original CRISPR TGTGCGTGCGTGGCTGGGGG AGG (reversed) Exonic
900004172 1:33668-33690 AGTGGGTGGGGGGCTGGGGGAGG - Intergenic
900023899 1:204184-204206 AGTGGGTGGGGGGCTGGGGGAGG - Intergenic
900165791 1:1243838-1243860 TGTGGGTTGGGGGCTGGGGGCGG - Intronic
900526038 1:3129149-3129171 CGTGCGTGTGTGGGTGGGTGTGG + Intronic
900596457 1:3482294-3482316 TGTGCGTGTGTGTTGGGGGGCGG + Intergenic
900605807 1:3523061-3523083 TGTGAGTGTGTGCCGGGGGGGGG + Intronic
900701320 1:4050181-4050203 CGTGGGTGCATGGGTGGGGGTGG + Intergenic
900710083 1:4108049-4108071 TGTGTGTGTGTGTTTGGGGGGGG - Intergenic
901179975 1:7335125-7335147 TGTGTGTGTGTGTGTGGGGGGGG + Intronic
901179979 1:7335129-7335151 TGTGTGTGTGTGGGGGGGGGGGG + Intronic
901386578 1:8913390-8913412 TGTGCGGGGGTGGGTGGGTGTGG + Intergenic
901499680 1:9644074-9644096 TGGGCATGCGTGGGTGGTGGTGG + Intergenic
901659862 1:10792333-10792355 TTTGTGTGCGGGGCCGGGGGGGG - Intronic
901799274 1:11698051-11698073 TGTGTGTGGGTGGGTGGTGGTGG - Intronic
901831801 1:11897303-11897325 TGTGTGTGTGTGTCGGGGGGAGG - Intergenic
901908732 1:12437055-12437077 TGTGTGTGTGTGGCGGCGGGAGG + Intronic
902376133 1:16030716-16030738 TGTTTGGGCTTGGCTGGGGGTGG + Intronic
902396582 1:16135191-16135213 TGTGGGTGGGTGGCCGGCGGAGG + Intronic
902449120 1:16485457-16485479 TGTGAGTGGGATGCTGGGGGTGG + Intergenic
902468171 1:16630796-16630818 GGTGGGGGCGTGTCTGGGGGAGG - Intergenic
902468512 1:16632163-16632185 TGTGAGTGGGATGCTGGGGGTGG + Intergenic
902506583 1:16942657-16942679 ACAGCGTGTGTGGCTGGGGGTGG + Intronic
902579363 1:17398658-17398680 GGTGGGTGGGTGGGTGGGGGGGG - Intronic
902579367 1:17398662-17398684 TGTGGGTGGGTGGGTGGGTGGGG - Intronic
902794324 1:18791191-18791213 TGTGTGTGTGTGTTTGGGGGTGG - Intergenic
903106330 1:21083466-21083488 AGTGTGTGTGTGGCTGGGTGTGG - Intronic
903154611 1:21435484-21435506 TGTGAGTGGGACGCTGGGGGTGG - Intergenic
903284312 1:22267627-22267649 TGTGTGTGCGTTGTTGGGGTGGG + Intergenic
903531844 1:24037031-24037053 TGTGTGTGTGAGGCTGGGCGTGG + Intergenic
903572755 1:24318581-24318603 TGTGTGTTGGTGGCAGGGGGTGG - Intergenic
903622453 1:24707806-24707828 TGTGTGTGTGTGTGTGGGGGGGG + Intergenic
903622457 1:24707810-24707832 TGTGTGTGTGTGGGGGGGGGGGG + Intergenic
903634753 1:24804385-24804407 TGTGGGTGGGTGGGTGGAGGGGG + Intronic
903634806 1:24804558-24804580 TGTGTGTACGTGGGTGGGTGGGG + Intronic
903674014 1:25053192-25053214 TGTGTGTGTGGGGATGGGGGTGG - Intergenic
903693996 1:25194349-25194371 TGTGGGTGCGAGGATGTGGGTGG - Intergenic
903737189 1:25537489-25537511 TGTGGATGCTAGGCTGGGGGAGG + Intergenic
904029469 1:27525241-27525263 TGTGCATGCTTGGCAGGGTGTGG + Intergenic
904095274 1:27972105-27972127 TGTGCTTGCGTGCATGGTGGGGG + Exonic
904244972 1:29181454-29181476 TGCGCCTGCGCGGGTGGGGGTGG - Intronic
904944475 1:34189348-34189370 TGTGTGTGTGTGGCGGGGGGTGG + Intronic
905174409 1:36126802-36126824 TGTGCGTGGGGGGGTGTGGGGGG + Intergenic
905347271 1:37319541-37319563 TGCGCGTGTGTGCCTGGGTGAGG + Intergenic
905352789 1:37359125-37359147 TGTGTGTTGGGGGCTGGGGGTGG + Intergenic
905868995 1:41392144-41392166 TGTGTGTGTGTGGGTGGGTGGGG + Intergenic
905948030 1:41920099-41920121 TGTGTGTGTGTCGCTGGGAGGGG - Intronic
906783243 1:48591088-48591110 TGTGTGTGTGTGGGGGGGGGTGG - Intronic
906783245 1:48591092-48591114 TGTGTGTGTGTGTGTGGGGGGGG - Intronic
907290723 1:53411001-53411023 TGTGTGTGTGTGGCTGGTGGGGG + Intergenic
907617879 1:55943138-55943160 TGTGTGTGTGTGGAGGGGGGTGG + Intergenic
908044543 1:60154453-60154475 TGTACGTGTGTGGGTGGTGGGGG + Intergenic
908153701 1:61330437-61330459 TGTGTGTGTGTGTGTGGGGGGGG - Intronic
908384356 1:63627055-63627077 TGTGTGTGTGTGGGGGGGGGGGG - Intronic
909457097 1:75862004-75862026 TGTGGGAGCTTGGCAGGGGGAGG - Intronic
909764718 1:79341276-79341298 TGTGTGTGTGTGGGTGGGGGGGG - Intergenic
910250992 1:85199753-85199775 TGTGTGTGCGTGCCTGGGAGAGG + Intronic
910745699 1:90571900-90571922 TGTGTGTGTGTGTGTGGGGGGGG + Intergenic
910915655 1:92285463-92285485 GGGGCGTGGGGGGCTGGGGGAGG + Intronic
911261694 1:95693988-95694010 TGTGTGTGTGTGGCGGGGTGAGG + Intergenic
911383748 1:97148239-97148261 TGTGTGTGTGTGTGTGGGGGGGG + Intronic
912228764 1:107767702-107767724 TGTACATGCGTGCATGGGGGTGG + Intronic
912411524 1:109483782-109483804 TGTGAGTGGGTGGGGGGGGGGGG + Intronic
913091377 1:115478940-115478962 AGTGCGTGTGGGGGTGGGGGAGG + Intergenic
913293741 1:117299143-117299165 TGTGTGTGTGTTGGTGGGGGGGG + Intergenic
913998853 1:143675340-143675362 TTTGGGTGCGTGTCTGGGGCAGG + Intergenic
914251885 1:145928564-145928586 TGTGTGTGTGTGTGTGGGGGGGG - Intergenic
914905779 1:151742348-151742370 TGGGCATGCGAGGCTGGGCGTGG + Intergenic
916056856 1:161073917-161073939 TGTGAGTGTGTGGCTGCAGGTGG + Intronic
916349066 1:163828231-163828253 TTTGCATGCGTGGTTGGGAGTGG + Intergenic
916505379 1:165423689-165423711 AGTGTGTGTGTTGCTGGGGGCGG + Intronic
916911407 1:169351074-169351096 TGTGTGTGTGTGGTTGTGGGTGG - Intronic
916963965 1:169916219-169916241 TGTGTGTGTGTGGCGGGGGGGGG + Intergenic
917030664 1:170687012-170687034 TGAGGGTGGGGGGCTGGGGGAGG - Intronic
917121054 1:171645195-171645217 TCTGGGTCCGTGGCTGGGGTAGG - Intronic
917788995 1:178487476-178487498 TGGGGGTGCGTGGCTGGGTGAGG - Intergenic
917879586 1:179321194-179321216 TGTGAGTTCATGGCTGGGCGTGG - Intronic
918191900 1:182183839-182183861 TGTGCATGTGTGTCTGGGGTGGG - Intergenic
918651264 1:186966215-186966237 TGTGTGTGGGTGGTTGGGGGTGG + Intronic
918766011 1:188484473-188484495 TGTGTGTGTGTGGGGGGGGGGGG - Intergenic
918881620 1:190131167-190131189 TATGTGTGTGTGGCGGGGGGTGG + Intronic
919165109 1:193882111-193882133 TGTGTGTGTGTGTGTGGGGGGGG + Intergenic
919165113 1:193882115-193882137 TGTGTGTGTGTGGGGGGGGGGGG + Intergenic
919419634 1:197354848-197354870 TGTGGGTGGGTGGGCGGGGGGGG - Intronic
919983248 1:202655725-202655747 TGCGCTTGCGAGGCTGAGGGAGG + Intronic
920030645 1:203035497-203035519 TGAGTGTGCGTGTGTGGGGGTGG - Intronic
920069104 1:203289738-203289760 TGTGCGTGCCTGCCTGTGGTGGG - Intergenic
920184101 1:204149981-204150003 AGTGCGTGGGTGGGTGGGTGGGG + Intronic
920230440 1:204466469-204466491 TGTGCATGGGCGGCGGGGGGTGG + Intronic
920251319 1:204624256-204624278 TGTGTGTGTGTGGCTGGGCCTGG + Intronic
920277370 1:204816675-204816697 TGTGTGTGCTTGTGTGGGGGTGG + Intergenic
921116802 1:212099522-212099544 TGTGAGAGGGTGGCTGGGTGTGG - Intronic
921348768 1:214214161-214214183 TGTGTGTGTGTGGTGGGGGGGGG - Intergenic
921354435 1:214273226-214273248 AGTGAGTGCTTGGCTGGGGTTGG + Intergenic
921419734 1:214932624-214932646 TGGGGGTGCGGGGCTAGGGGAGG - Intergenic
921566133 1:216723185-216723207 TGGGGGTGCGGGGGTGGGGGCGG - Intronic
921592919 1:217024480-217024502 TGTGGGTGGGTGGCTGTGGAGGG - Intronic
921918949 1:220644451-220644473 TGTGTGTGTGTGGGGGGGGGGGG - Intronic
922227376 1:223656972-223656994 TGTGTGTATGTGGCTGGGCGCGG - Intronic
922434804 1:225593390-225593412 TGTGTGTGTGTGGGGGGGGGGGG + Intronic
922958435 1:229625405-229625427 TGATCGTGCGTGGGTGGGTGTGG - Intronic
923055832 1:230425681-230425703 TGTGCGTCCGGGGCGCGGGGCGG + Intronic
923066959 1:230527114-230527136 CGTGCAAGCTTGGCTGGGGGAGG - Intergenic
923899924 1:238314584-238314606 TGTGTGTGTGTGTCGGGGGGGGG + Intergenic
924235997 1:242000050-242000072 TGTGTGTGTGTGGGTGGGTGGGG + Intergenic
924748977 1:246867895-246867917 TGTGTGTGTGTGTGTGGGGGGGG - Intronic
924761588 1:246992404-246992426 AGTGGGTGAGTGGGTGGGGGAGG + Intronic
1063039241 10:2319981-2320003 TGTGTGTGTGTGGTGGGGGGAGG - Intergenic
1063397784 10:5707678-5707700 TGTGTGTGTGGGGTTGGGGGGGG - Intronic
1063528753 10:6809861-6809883 TGTGGCAGCGAGGCTGGGGGAGG - Intergenic
1063752362 10:8965008-8965030 TGTGTGTGTGTGGGGGGGGGGGG - Intergenic
1063752366 10:8965012-8965034 TGTGTGTGTGTGTGTGGGGGGGG - Intergenic
1064323551 10:14328355-14328377 TGTGTGTGTGTGGGTGGGGGGGG + Intronic
1064323555 10:14328359-14328381 TGTGTGTGGGTGGGGGGGGGGGG + Intronic
1064451343 10:15444847-15444869 TGTGTGTGTGTGGGGGGGGGGGG - Intergenic
1064608086 10:17065134-17065156 TGTGCATGTGTGTGTGGGGGGGG - Intronic
1064709297 10:18107284-18107306 TGTGTGTGTGTTGCAGGGGGCGG + Intergenic
1065191289 10:23211464-23211486 TGTGTGTGTGTGTGTGGGGGGGG + Intronic
1065191293 10:23211468-23211490 TGTGTGTGTGTGGGGGGGGGGGG + Intronic
1065237843 10:23672136-23672158 TGTGGCAGCGAGGCTGGGGGAGG - Intergenic
1065882799 10:30051254-30051276 TGTGCGTGCGTGTGTGCGTGTGG - Intronic
1065892311 10:30131792-30131814 TGTGTGTGCGGGTCGGGGGGTGG - Intergenic
1066169635 10:32827643-32827665 TGGGGGTGGGGGGCTGGGGGAGG + Intronic
1066360734 10:34727868-34727890 TGTGTGTGTGTGGCGGAGGGAGG - Intronic
1066467849 10:35669181-35669203 TGTGCGTGCGTGTGTGTAGGGGG + Intergenic
1066549688 10:36543020-36543042 TGTGTGTGTGTGTGTGGGGGGGG - Intergenic
1067228328 10:44389710-44389732 TGTGTGTGTGTGTGTGGGGGGGG + Intergenic
1067250123 10:44578952-44578974 TGTGGGTGGGGGGCTGGGGGAGG - Intergenic
1067414463 10:46092935-46092957 TGTGCATGGGTGGGTGGGTGTGG - Intergenic
1067451776 10:46386100-46386122 TGTGTGTGCATGACTGTGGGTGG + Intronic
1067498634 10:46781863-46781885 TGTGTGTGTGTGTTTGGGGGTGG - Intergenic
1067516306 10:46948742-46948764 GGTGCTTGCGTGCCTGGGGAGGG + Intronic
1067562321 10:47312543-47312565 GGTGCGTGGGTGGGTGAGGGCGG + Intronic
1067585462 10:47473655-47473677 TGTGTGTGCATGACTGTGGGTGG - Intronic
1067645943 10:48103051-48103073 GGTGCTTGCGTGCCTGGGGAGGG - Intergenic
1067681189 10:48442292-48442314 TGTGCATGCAGGGCAGGGGGTGG + Intergenic
1067711564 10:48655242-48655264 TGTGTGTGTGTGTGTGGGGGGGG + Intronic
1067711568 10:48655246-48655268 TGTGTGTGTGTGGGGGGGGGGGG + Intronic
1067848769 10:49742212-49742234 TGTGCGTGTGTGGTTTGTGGGGG - Intronic
1067872577 10:49975569-49975591 TGTGTGTGTGTGTGTGGGGGGGG + Intergenic
1067878060 10:50021510-50021532 TGTGTGTGTGTGGGGGGGGGGGG + Intergenic
1067974702 10:51011198-51011220 TGTGTGTGTGTGGGTGGGGAGGG + Intronic
1067991864 10:51223001-51223023 TGTTTGTGTGTGGCGGGGGGTGG + Intronic
1068173394 10:53424625-53424647 TGTGTGTGTGTGTGTGGGGGGGG + Intergenic
1068405643 10:56585494-56585516 TGTGTGTGTGTGTGTGGGGGGGG - Intergenic
1068608511 10:59032733-59032755 TGTGTGTGTGTGTGTGGGGGGGG + Intergenic
1068835758 10:61551666-61551688 TGTGTGTGTGTGGAGGGGGGCGG + Intergenic
1068942724 10:62695662-62695684 TGTGTGTGTGTGGCGGGGGAGGG - Intergenic
1068954486 10:62809917-62809939 TGTGTGTGTGTCGGTGGGGGGGG - Intergenic
1069582041 10:69572918-69572940 TGTGCGAGTGGGGCTGGGCGGGG + Exonic
1069873651 10:71548282-71548304 TGTGTGTGCGTGGTGGAGGGGGG + Intronic
1070112113 10:73496029-73496051 TGCGCGTGCGGGGGTGGGGGCGG + Intergenic
1070150251 10:73800874-73800896 TGTGCGTGCGCGGGGGGCGGAGG + Intronic
1070524824 10:77286758-77286780 TGTGTGTGCGGGGGGGGGGGGGG + Intronic
1071058182 10:81535375-81535397 TGTATGTGTGTGGGTGGGGGAGG + Intergenic
1071306457 10:84303155-84303177 TGTGTGTGTGTGGCGGCGGGGGG + Intergenic
1071547314 10:86538455-86538477 GGTGGGGGCGTGGGTGGGGGTGG - Intergenic
1071945992 10:90645561-90645583 AGTGGGTGAGGGGCTGGGGGAGG - Intergenic
1072153493 10:92702453-92702475 TGAGGGTGCGGGGCTTGGGGAGG - Intergenic
1072727562 10:97823954-97823976 TGGGCGTGTGTGGGTGGGGCAGG + Intergenic
1073037091 10:100571629-100571651 CTTGCATGCGGGGCTGGGGGTGG - Intergenic
1073044743 10:100630248-100630270 TGTGTGTGTGTGTCTGGCGGCGG + Intergenic
1073090009 10:100928035-100928057 TGTGTGTGTGTGGGGGGGGGGGG - Intronic
1073090013 10:100928039-100928061 TGTGTGTGTGTGTGTGGGGGGGG - Intronic
1073186360 10:101617587-101617609 TGTGCGTGGGTGGGTGCTGGGGG - Intronic
1073727639 10:106252873-106252895 TGTGCATGGCTGGGTGGGGGAGG - Intergenic
1074227485 10:111499939-111499961 TGTGCATGTGTGTGTGGGGGAGG + Intergenic
1074332062 10:112523575-112523597 TGTGTGTGTGTGGGTGGCGGGGG + Intronic
1074332064 10:112523579-112523601 TGTGTGTGGGTGGCGGGGGGAGG + Intronic
1074422202 10:113319165-113319187 TGTGTGTGTGTGGGGGGGGGGGG + Intergenic
1074454619 10:113586465-113586487 TGTGTGTGTGTGGGGGGGGGGGG + Intronic
1074511093 10:114112699-114112721 TGTGTGTGTGTGTCGGGGGGGGG - Intergenic
1074783255 10:116817512-116817534 TGTGTGTGTGTGGGTGGGGGTGG + Intergenic
1074869142 10:117563431-117563453 TGTGTGTTCGTGGGTGTGGGGGG + Intergenic
1075613581 10:123874370-123874392 TGTGTGTGTGTGGTTGGGGCGGG - Intronic
1076054723 10:127362987-127363009 TGTGCGTGTGTGTGTGGGGGGGG - Intronic
1076081209 10:127582507-127582529 TGTGTGTGTGTGTGTGGGGGGGG - Intergenic
1076134227 10:128034326-128034348 TGTGTGTGTGTCGGTGGGGGGGG - Intronic
1076401963 10:130190575-130190597 GGTGCCTGCGTGGCCGGGGCAGG + Intergenic
1076422030 10:130338592-130338614 TGTGCGTGTGTGTGTGGGGGGGG + Intergenic
1076710599 10:132331882-132331904 TGCGCGGGGGTGGCAGGGGGTGG - Intergenic
1076731193 10:132439990-132440012 TGTGCGTGTGTGCCTGCGTGTGG + Intergenic
1076761539 10:132608353-132608375 AGTGGGTGCTGGGCTGGGGGAGG + Intronic
1076896690 10:133316679-133316701 TGTGTGTGTGTGGGGGGGGGGGG - Intronic
1076896694 10:133316683-133316705 TGTGTGTGTGTGTGTGGGGGGGG - Intronic
1077179527 11:1206075-1206097 GGTGCGTGTGGGGTTGGGGGTGG + Intergenic
1077190802 11:1255311-1255333 CGTGCGTGCGTGCATGCGGGCGG - Intronic
1077213517 11:1384346-1384368 GGTGGGTGGGTGGCAGGGGGAGG - Intergenic
1077333164 11:1992230-1992252 TGTGCGTCTGTGCCTGGGAGCGG - Intergenic
1078334871 11:10455506-10455528 TCTGTGTGTGTGGATGGGGGTGG + Intronic
1078429576 11:11278363-11278385 GGTGGGTGGGGGGCTGGGGGAGG + Intronic
1078514349 11:12009372-12009394 TGGGCGGGCGGGGCTCGGGGCGG - Intronic
1078869192 11:15328067-15328089 TGTGCATGACTGGGTGGGGGTGG + Intergenic
1078955582 11:16190781-16190803 TGTGTGTGCGTGGCAGTGGGAGG + Intronic
1078987044 11:16607032-16607054 TTTGCGTACTTGGCTGGGGAGGG - Intronic
1079213257 11:18483033-18483055 TGTGTGTGTGTAGCAGGGGGTGG + Intronic
1080136866 11:28865311-28865333 TGTGTGTGTGTGGTCGGGGGAGG + Intergenic
1080359817 11:31499828-31499850 TGTTTGTGCTTGGCTAGGGGTGG - Intronic
1080445423 11:32333590-32333612 CGCTCCTGCGTGGCTGGGGGCGG - Intergenic
1080678677 11:34452542-34452564 TGTGCGTGCGCGCATGCGGGAGG + Intronic
1080695571 11:34600574-34600596 TGTGGGTGAGTGGGTGGGGGTGG - Intergenic
1081020225 11:37937223-37937245 TGTGGGTGAGGGGCTAGGGGAGG - Intergenic
1081035636 11:38141666-38141688 TGTGTGTGTGTGTGTGGGGGGGG + Intergenic
1081593480 11:44443287-44443309 GGTGGGTGGGGGGCTGGGGGAGG + Intergenic
1081840744 11:46199778-46199800 TGTGTGTGTGTGGGTGGGTGGGG - Intergenic
1082059387 11:47847634-47847656 TGTGTGTGTGGGGGTGGGGGGGG + Intronic
1082740695 11:56907877-56907899 GGGGGGTGCGGGGCTGGGGGAGG - Intergenic
1082785793 11:57315748-57315770 TGTGTGTGTGTGGCGGTGGGGGG - Intronic
1082943951 11:58738914-58738936 TGTGTGTGTGTGGGGGGGGGGGG - Intergenic
1082943955 11:58738918-58738940 TGTGTGTGTGTGTGTGGGGGGGG - Intergenic
1083039032 11:59668778-59668800 TGTTCCTGCGGGGCAGGGGGCGG - Intronic
1083335254 11:61918141-61918163 TGTGTGTGTGTCGGTGGGGGTGG - Intronic
1083717984 11:64590204-64590226 TGTGTGTGCATGGCCGGGCGTGG - Intergenic
1083922189 11:65786999-65787021 TGTGTGTTGGTGGCTGGGGCGGG - Intergenic
1084028467 11:66467091-66467113 CGTGTTTGCGTGTCTGGGGGTGG + Intronic
1084161505 11:67352936-67352958 TGTGGGTGACTGGCTGGGAGAGG + Intronic
1084319196 11:68364038-68364060 TGCGCGGGCGTGGGTGGGGTGGG + Intronic
1084329387 11:68421737-68421759 TGTGTGTGTGTGTATGGGGGAGG + Intronic
1084329406 11:68421834-68421856 TGTGTGTGTGTGTATGGGGGAGG + Intronic
1084590070 11:70085328-70085350 TGTGGGTGGGTGGCTTGGGAGGG - Intronic
1084981294 11:72830105-72830127 TGTGTGTCTGTGCCTGGGGGAGG + Intronic
1085024947 11:73230913-73230935 TGTGGGTGGGTGGGTGGGGGTGG + Intronic
1085404724 11:76255006-76255028 TGTGTGTGCAGGGGTGGGGGTGG + Intergenic
1085954492 11:81375049-81375071 TGTGCTTGCGTGTGTGTGGGGGG + Intergenic
1086256132 11:84878555-84878577 GGTGGGTGGGTGGCTAGGGGAGG + Intronic
1086578079 11:88363209-88363231 TGTGGGAGTGTGGCTGGGGTTGG - Intergenic
1086645558 11:89215369-89215391 TGGGGGTGGGGGGCTGGGGGAGG + Intronic
1086905968 11:92418420-92418442 TGTGTGTGGGGGGGTGGGGGGGG - Intronic
1086928227 11:92664018-92664040 TGTGTGTGTGTGTTTGGGGGAGG - Intronic
1086959005 11:92963281-92963303 TGTGTGTGTGTGGCGGGTGGTGG + Intergenic
1086961435 11:92982937-92982959 TGTGTGTGTGTGGGGGGGGGGGG - Intronic
1086961439 11:92982941-92982963 TGTGTGTGTGTGTGTGGGGGGGG - Intronic
1087047612 11:93856127-93856149 TGTGTGTGTGTGTTTGGGGGGGG + Intergenic
1087118714 11:94550394-94550416 TGTGCGTGCGTGCGTGTGTGTGG - Intronic
1087298135 11:96400930-96400952 TGTGTGTGTGTGTATGGGGGGGG + Intronic
1087352151 11:97045850-97045872 GGTGGCAGCGTGGCTGGGGGAGG - Intergenic
1087833084 11:102840847-102840869 TATGCTTGTGAGGCTGGGGGTGG - Intronic
1088075143 11:105839051-105839073 GGTGCATGCATGGATGGGGGTGG - Intronic
1088118701 11:106342007-106342029 TGGGTGTGCGTGGCTGGGGCTGG + Intergenic
1088850185 11:113697882-113697904 TGTGTGTGTGTGTTTGGGGGCGG - Intronic
1089374219 11:117983165-117983187 TGTGCCAGGTTGGCTGGGGGTGG - Intergenic
1089615476 11:119692420-119692442 TGTGTGTGTGTGGGTGGCGGGGG + Intronic
1089615478 11:119692424-119692446 TGTGTGTGGGTGGCGGGGGTGGG + Intronic
1090287744 11:125514699-125514721 GGTGTGTGTGTGGCGGGGGGTGG + Intergenic
1090401513 11:126452494-126452516 TGTGGGTGCCGGGCTGGGGCTGG + Intronic
1090408220 11:126490219-126490241 TGTGTGTGTGTGGCGGGGGCGGG + Intronic
1090977748 11:131691169-131691191 TGTGGGTGCAGGGCCGGGGGTGG - Intronic
1091014235 11:132035628-132035650 TGTGTGTGTGTGGCAGTGGGAGG + Intronic
1091041636 11:132286517-132286539 TGTGTGTGTTTGGGTGGGGGGGG - Intronic
1091150807 11:133326656-133326678 TGTATGTGTGTGGGTGGGGGTGG + Intronic
1091277546 11:134362691-134362713 TGGGCGTGTGTGGCAGGTGGAGG - Intronic
1202816146 11_KI270721v1_random:47409-47431 TGTGCGTCTGTGCCTGGGAGCGG - Intergenic
1091377595 12:35716-35738 AGTGGGTGGGGGGCTGGGGGAGG - Intergenic
1091382923 12:74460-74482 TGTGTGTGCCCGGGTGGGGGTGG + Intronic
1091598378 12:1897225-1897247 TGTGTGTGGGTGAGTGGGGGAGG + Intronic
1091799514 12:3316092-3316114 TGTGTGTGTGTGGTGGGGGGTGG + Intergenic
1092008209 12:5087385-5087407 TGTGTGTGTGTGGTTGGGGAGGG + Intergenic
1092020705 12:5200070-5200092 GCTGGGTGGGTGGCTGGGGGAGG + Intergenic
1092046917 12:5437876-5437898 TGTGCGTGCGTGCGTGCTGGGGG + Intronic
1092172397 12:6382281-6382303 AGTGTGTGCGTTGGTGGGGGAGG + Intronic
1092226078 12:6749086-6749108 TGTGCGTGCAGGGATGGGTGGGG + Intronic
1092282579 12:7108974-7108996 TGTGTGTGTGTGTGTGGGGGGGG + Intronic
1092282583 12:7108978-7109000 TGTGTGTGTGTGGGGGGGGGGGG + Intronic
1092610002 12:10162535-10162557 TGTACGTTTTTGGCTGGGGGTGG + Intronic
1093380168 12:18482157-18482179 GGTGCGAGGGTGGCGGGGGGCGG - Intronic
1093381120 12:18494387-18494409 TGTGTGTGTGTGGGTGGGTGTGG + Intronic
1093417413 12:18935618-18935640 TGTAGGTGGGTGGGTGGGGGTGG - Intergenic
1093711488 12:22334307-22334329 TGTGCATGGGGGGCTGGCGGTGG - Exonic
1094078821 12:26509993-26510015 TGTGTGTGTGTGGTGGGGGGTGG + Intronic
1094579253 12:31718906-31718928 TGTGGGAGCTTGGCGGGGGGAGG - Intronic
1095106696 12:38242442-38242464 TGTGTGTGTGTGGGTGGGGGTGG - Intergenic
1095577634 12:43758655-43758677 TGTGTGTGTGTGGGGGGGGGGGG - Exonic
1095577638 12:43758659-43758681 TGTGTGTGTGTGTGTGGGGGGGG - Exonic
1095949270 12:47773157-47773179 TGTGCGGGCGGCGCTGGGGGCGG + Intronic
1096252280 12:50040903-50040925 TGTGTGTGGGTGTGTGGGGGTGG - Intergenic
1096780600 12:53989718-53989740 TGTGAGTGCGTGGGTGAGTGAGG - Exonic
1096847900 12:54418201-54418223 TGTGCGCGCGTGAAGGGGGGTGG - Intronic
1097144938 12:56933646-56933668 TGGACGTGCCTGGCTGGGCGTGG - Intronic
1097424496 12:59426237-59426259 TGTGTGTGTGTGGCGGGGGGGGG - Intergenic
1097539942 12:60928441-60928463 AGTGTGTGTGTGGCCGGGGGTGG + Intergenic
1097815804 12:64072141-64072163 TGTGTGTGGGCGGCGGGGGGGGG + Intronic
1098027976 12:66225444-66225466 TGTGTGTACGTGGCGGGGGAGGG - Intronic
1098291132 12:68957833-68957855 AGGGGGTGGGTGGCTGGGGGAGG - Intronic
1098350676 12:69555995-69556017 AGTGTGTGTGTGGCGGGGGGGGG + Intronic
1098420859 12:70296133-70296155 TGTGTGTGTGTTGGTGGGGGAGG - Intronic
1098597802 12:72294359-72294381 TGTGTGTGTGTGGTGGGGGGCGG + Intronic
1098922523 12:76315566-76315588 TGTGTGTGGGGGGTTGGGGGAGG - Intergenic
1099219067 12:79890891-79890913 TGTGTGTGGGTGGGTGTGGGTGG - Intronic
1099219069 12:79890895-79890917 TGTGTGTGTGTGGGTGGGTGTGG - Intronic
1099286493 12:80718599-80718621 TGTGCGTGCGTGTCTGCTAGGGG - Intronic
1099428274 12:82550926-82550948 TTTGGCAGCGTGGCTGGGGGAGG - Intergenic
1099542628 12:83932131-83932153 TGTGTGTGTGTGGGGGGGGGGGG + Intergenic
1099653920 12:85465280-85465302 TGTGTGTGTGTGGTGGGGGGAGG + Intergenic
1100028459 12:90157776-90157798 TGTGTGTGTGTGTGTGGGGGGGG + Intergenic
1100171420 12:91979008-91979030 TATGTGTGTGTGGATGGGGGAGG - Intergenic
1100419331 12:94416595-94416617 TTTGCTTGTGTGGATGGGGGTGG - Intronic
1100439133 12:94599560-94599582 TGTGTGTGTGTGGGCGGGGGGGG - Intronic
1100629690 12:96375362-96375384 TGTGTATGTGTGGCTGAGGGTGG - Intronic
1100829226 12:98502833-98502855 TGTGTGTGTGTGTGTGGGGGGGG - Intronic
1100926300 12:99551937-99551959 TGTGTGTGTGTGGTGGGGGGAGG - Intronic
1100929526 12:99590248-99590270 TGTGTGTGTGTGGGTGGGTGTGG - Intronic
1101259531 12:103013941-103013963 TCTGCCTGCGTTCCTGGGGGAGG + Intergenic
1101333906 12:103779567-103779589 TGTGCGTGGGTGGGTGGATGGGG - Intronic
1101660683 12:106762842-106762864 TGTGTGTGTGTGTGTGGGGGGGG + Intronic
1101660687 12:106762846-106762868 TGTGTGTGTGTGGGGGGGGGGGG + Intronic
1101757939 12:107635852-107635874 TGTGGGTGGGTGGGGGGGGGGGG - Intronic
1101757943 12:107635856-107635878 TGTGTGTGGGTGGGTGGGGGGGG - Intronic
1101757947 12:107635860-107635882 TGTGTGTGTGTGGGTGGGTGGGG - Intronic
1101806688 12:108070126-108070148 TGTGTGTGTGTGTGTGGGGGGGG - Intergenic
1101816444 12:108149667-108149689 TGTGTGTGTGTGGCGGGGTGGGG - Intronic
1101880723 12:108623763-108623785 TGTGCTTCCGTGGCTGCTGGTGG + Exonic
1102009198 12:109607604-109607626 TGTGTGTGTGTGGCGGGGGTGGG - Intergenic
1102119562 12:110429699-110429721 TGTGTATGCGTGGGTGGGCGGGG + Intergenic
1102224949 12:111221805-111221827 TGTGTGTGCGTGCCGGTGGGAGG + Intronic
1102863900 12:116359322-116359344 TGTGTGTGTGTGGGGGGGGGGGG + Intergenic
1102920094 12:116785264-116785286 TGTGTGTGTGTGGCGGGGGGGGG + Intronic
1103032004 12:117623373-117623395 TCGGGGTGCGGGGCTGGGGGAGG - Intronic
1103173697 12:118843866-118843888 TGTGTGAACCTGGCTGGGGGAGG - Intergenic
1104237098 12:126949753-126949775 TATGTGTGTGTGGGTGGGGGTGG + Intergenic
1104424569 12:128664758-128664780 TGTGCATGGCTGGCTGGCGGTGG - Intronic
1104636228 12:130439490-130439512 TGTGTGTGCGTGTCTGTGGGTGG + Intronic
1104916544 12:132268261-132268283 TGTGCGTGCGTGTGTAGGGGTGG - Intronic
1105279472 13:18954902-18954924 TGTGAGTGCCTGGATGGGAGGGG - Intergenic
1106227934 13:27799048-27799070 TGTGTGTGTGTGGGGGGGGGGGG - Intergenic
1106365307 13:29073534-29073556 TGTGTGTGTGTGTTTGGGGGTGG + Intronic
1106993959 13:35459007-35459029 TGTGTGTGTGTGGGGGGGGGGGG - Intronic
1106993963 13:35459011-35459033 TGTGTGTGTGTGTGTGGGGGGGG - Intronic
1107484462 13:40813124-40813146 TGTGTGTGGGTGGGGGGGGGGGG - Intergenic
1107484466 13:40813128-40813150 TGTGTGTGTGTGGGTGGGGGGGG - Intergenic
1108073966 13:46659673-46659695 TGTGTGTGGGTGGCTGTGGGGGG + Intronic
1108187320 13:47901195-47901217 TGGGGGTGCGGGGCTAGGGGAGG + Intergenic
1108321585 13:49295534-49295556 TGTGCATGAGGGGCTGGGGGTGG + Intergenic
1108363710 13:49690492-49690514 TGCGCGTGTGTGGTGGGGGGCGG + Intronic
1109250673 13:60016480-60016502 TCTGGGTGCGTGGGTGGGGGAGG - Intronic
1109763329 13:66860320-66860342 TGTGCTTTATTGGCTGGGGGAGG + Intronic
1109818456 13:67619317-67619339 TGTGTGTACGTGGCTGGGGATGG - Intergenic
1109899920 13:68753923-68753945 GGGGGGTGCGGGGCTGGGGGAGG + Intergenic
1110408622 13:75179118-75179140 TGTGTGTGTGTGGGTGGGGGGGG + Intergenic
1110898709 13:80792388-80792410 TGTGCGTGTGTTGGGGGGGGTGG - Intergenic
1110993984 13:82081662-82081684 TGTGTGTGCGTGGATGTGTGGGG + Intergenic
1110993986 13:82081666-82081688 TGTGCGTGGATGTGTGGGGGAGG + Intergenic
1111006026 13:82250115-82250137 TGTGTGTGTGTGTCTTGGGGTGG + Intergenic
1111232732 13:85364358-85364380 TGTGGGTGGGTGGGTGGAGGGGG + Intergenic
1111640084 13:90957604-90957626 TGTGTGTGTGGGGGTGGGGGGGG - Intergenic
1111649309 13:91069195-91069217 TGTGTGTGTGTGTCTGGGTGGGG + Intergenic
1111786318 13:92791410-92791432 TGTGTGTGAGTGTGTGGGGGGGG + Intronic
1111786320 13:92791414-92791436 TGTGAGTGTGTGGGGGGGGGCGG + Intronic
1111940382 13:94601275-94601297 TCTGCGGGCGGGGGTGGGGGTGG + Intergenic
1112511894 13:100017155-100017177 TGTGCGTGCTTGGATGGGCACGG + Intergenic
1112726495 13:102310686-102310708 TGTGTGTGTGTGGGGGGGGGGGG + Intronic
1112854791 13:103754508-103754530 TGTGGGTGAGGGGCGGGGGGAGG + Intergenic
1112933157 13:104766485-104766507 TGTGTGTGTGTGGGTGGGGGTGG - Intergenic
1113120723 13:106921335-106921357 TGTGTGTGTGTGGCGGGGAGGGG + Intergenic
1113389593 13:109882663-109882685 TGTGTGTGTGTGGGGGGGGGGGG + Intergenic
1113454546 13:110438800-110438822 TGTGTGTGTGTGGGGGGGGGTGG - Intronic
1113739686 13:112702578-112702600 TGTGCGTGCGTCTCTCTGGGTGG + Intronic
1113772674 13:112920652-112920674 TGTGGGTGGGTGCCAGGGGGAGG + Intronic
1113795502 13:113055372-113055394 TGTGTGTGTGTGGCGGGGGGGGG - Intronic
1114600448 14:23951967-23951989 TCTGTGTGTGCGGCTGGGGGAGG - Intergenic
1114683244 14:24505200-24505222 TGTGTGTGTGTGTATGGGGGGGG - Intronic
1115415372 14:33126476-33126498 TGTGTGTGCAGGGCTGGGGATGG + Intronic
1115730197 14:36260198-36260220 GGTGGGTGGGGGGCTGGGGGAGG + Intergenic
1115835089 14:37393415-37393437 TGTGTGTGTGTGGCGGGGGTGGG + Intronic
1115888727 14:38003716-38003738 TGTGTGTGTGTGGTGGGGGGCGG + Intronic
1116133824 14:40894866-40894888 TGTGTGTGTGTGTGTGGGGGGGG - Intergenic
1116628735 14:47301285-47301307 TGTGTGTGTGTGGGTGGGTGTGG - Intronic
1116676517 14:47912692-47912714 TGTGTGTGTGTGGCGGGGGGTGG + Intergenic
1116687490 14:48058882-48058904 TGTGTGTGTGTGTTTGGGGGAGG - Intergenic
1117548497 14:56811802-56811824 GGTGGGTGGGTGGCGGGGGGTGG - Intergenic
1117750794 14:58921718-58921740 TGTGTGTGTGTGGCAGGGGAGGG - Intergenic
1117803975 14:59470935-59470957 AGTGTGGGGGTGGCTGGGGGCGG + Intronic
1118064947 14:62180511-62180533 AGTGTGTGTGTGGGTGGGGGTGG + Intergenic
1118339164 14:64880061-64880083 GGTGCGTGAGTGGGTGGGGAAGG - Intergenic
1118736207 14:68703416-68703438 TGTGCGGATGTGGGTGGGGGCGG - Intronic
1118926140 14:70191096-70191118 TGTGCGGGGGTGGCGGGGTGGGG + Intergenic
1119537014 14:75410721-75410743 TGTGTGTGTGTGGCAGGGAGGGG + Intergenic
1119637203 14:76283715-76283737 TGTGAGTGCGTGTCTGTGTGTGG - Intergenic
1119740111 14:77008613-77008635 TGTGTGTGAGTGAGTGGGGGAGG + Intergenic
1120008121 14:79382989-79383011 TGTGGGTGGGTGGGTGAGGGTGG + Intronic
1120937803 14:89914966-89914988 TGTGTGTGTGTGGGCGGGGGCGG - Intronic
1120993349 14:90397527-90397549 AGTGGGTGCGGGGCTGGGCGGGG - Intronic
1121148443 14:91607070-91607092 TGTGTGTGTGTGGGCGGGGGGGG + Intronic
1121323156 14:93004627-93004649 TGTGCGTGCGTGTGTGGTGATGG + Intronic
1121488799 14:94343202-94343224 TGTGTGTGTGTGGCAGGGGTGGG - Intergenic
1121841943 14:97141859-97141881 TGTGTGTGTGTGTCGGGGGGGGG + Intergenic
1121879434 14:97486907-97486929 TGGGCGGGCGAGGCCGGGGGCGG + Intergenic
1122209983 14:100167580-100167602 TGTGTGTGTGTGTGTGGGGGTGG - Intergenic
1122219733 14:100229696-100229718 TGTGTGTGTGTGGCAGGTGGAGG + Intergenic
1122231612 14:100308918-100308940 TGTGTGTGTGTGGTCGGGGGAGG + Intergenic
1122239905 14:100356384-100356406 TGTGTGTGTGTGTGTGGGGGGGG + Intronic
1122264137 14:100538872-100538894 TGAGCCTGCGTAGCTGGGGAAGG + Exonic
1122371690 14:101232548-101232570 TGTGCGTACCTGCCTGTGGGGGG - Intergenic
1122945298 14:105005905-105005927 TGTGCATGCGCAGCTGGAGGGGG - Intronic
1123105401 14:105839082-105839104 TGGGCGTGGGAGCCTGGGGGAGG + Intergenic
1123112481 14:105879866-105879888 TGTGTGTAAGTGGTTGGGGGAGG + Intergenic
1123162686 14:106294520-106294542 TGTGTGTGCTTGTCTGAGGGAGG + Intergenic
1123207232 14:106725321-106725343 TGTGCGTGTGTGTGTGGGGGGGG - Intergenic
1123504757 15:20929890-20929912 TGTGTGTGTGTGGCGGCGGGGGG + Intergenic
1123562004 15:21503585-21503607 TGTGTGTGTGTGGCGGCGGGGGG + Intergenic
1123598250 15:21940872-21940894 TGTGTGTGTGTGGCGGCGGGGGG + Intergenic
1124047748 15:26165924-26165946 TGTGTGTGTGTTGGTGGGGGCGG + Intergenic
1124068951 15:26373179-26373201 TGTGTGTGTGTGTGTGGGGGGGG - Intergenic
1124117874 15:26864724-26864746 TGTGTTTGCGTGGTTGGGTGTGG - Intronic
1124432439 15:29619100-29619122 TTTGCATGCATGGCTGGGCGCGG + Intergenic
1124454623 15:29829389-29829411 TGTGCGAGGGTGCCTGGAGGAGG + Intronic
1124719469 15:32098860-32098882 TGTGTGTGTGTTGGTGGGGGGGG - Intronic
1124827739 15:33115496-33115518 TGTGCGTGTGTGTGTGGGGGGGG - Intronic
1124854502 15:33374410-33374432 TGGGTGTGTGTGGGTGGGGGTGG - Intronic
1124877727 15:33611264-33611286 TGTGTGTGTGGGGCTGGGCGCGG + Intronic
1124884229 15:33669833-33669855 TGTGTGTGTGTGGGGGGGGGGGG + Intronic
1125183982 15:36909841-36909863 TGTGTGTGTGGGGGTGGGGGTGG + Intronic
1125333485 15:38604856-38604878 TGTGCGTGCGTGTGTGTCGGGGG + Intergenic
1125353984 15:38797617-38797639 TGAGGGTGAGGGGCTGGGGGAGG - Intergenic
1125419326 15:39488316-39488338 TGTGTGTGTGTGGTGGGGGGTGG - Intergenic
1125435384 15:39638843-39638865 TGTGTGTGTGTGGTGGGGGGTGG + Intronic
1125950297 15:43746252-43746274 TGGGCGAGCGTGGCTGGGCCCGG - Intergenic
1126419532 15:48456869-48456891 TGTGCGTGCATGTGTTGGGGTGG + Intronic
1126654720 15:50964945-50964967 TGTGTGTGTGTGGTAGGGGGAGG - Intronic
1127283013 15:57508187-57508209 TGTGTGTGTGGGGCGGGGGGAGG - Intronic
1127453772 15:59140075-59140097 TGTGTGTGTGTGTATGGGGGTGG + Intronic
1128678793 15:69631298-69631320 TGTGTGTGTGTGGTGGGGGGAGG + Intergenic
1128751592 15:70154146-70154168 TGTGCGTGTGTTGTTGGGGGAGG - Intergenic
1129053078 15:72798362-72798384 TGTGTGTGTTTGGCGGGGGGTGG + Intergenic
1129084327 15:73072697-73072719 TGTGCTTGCGTGCATGGAGGTGG + Intronic
1129150653 15:73685484-73685506 TGTGTGTGTGTGGCGGGTGGGGG + Intronic
1129194287 15:73954904-73954926 TGTGTGTCCGTGGCAGGGTGGGG - Intergenic
1129233710 15:74211129-74211151 TGTGCGTGCGTAGTGGTGGGGGG - Intronic
1129423651 15:75450508-75450530 GGAGCGTGCGTGGCTGGTGCTGG - Intronic
1130098235 15:80872014-80872036 TGTGCTTGGGAGGCCGGGGGAGG - Intronic
1130186042 15:81683514-81683536 TGTGTGTGTGTGGGGGGGGGGGG - Intergenic
1130186046 15:81683518-81683540 TGTGTGTGTGTGTGTGGGGGGGG - Intergenic
1130251708 15:82304238-82304260 GGTGGGTGGGTGGCTTGGGGTGG + Intergenic
1130959004 15:88647451-88647473 TATGTGTGCGTGGCAGGGGAGGG - Intronic
1131250725 15:90828353-90828375 GGACCGTGCGTGGATGGGGGCGG + Intergenic
1131509119 15:93039537-93039559 AGTGGGTGGGGGGCTGGGGGAGG - Intronic
1131765108 15:95667630-95667652 TGTGTGTGTGTGGCGGTGGGGGG - Intergenic
1131808478 15:96147893-96147915 TGTGTGTGTGTGGGGGGGGGGGG - Intergenic
1131808482 15:96147897-96147919 TGTGTGTGTGTGTGTGGGGGGGG - Intergenic
1132166957 15:99602723-99602745 TGTGTGTGGGGGGGTGGGGGTGG + Intronic
1132226271 15:100144259-100144281 TGTGATTCCGTGGCTGGGCGTGG + Intronic
1132449332 15:101957276-101957298 AGTGGGTGGGGGGCTGGGGGAGG + Intergenic
1202970349 15_KI270727v1_random:230723-230745 TGTGTGTGTGTGGCGGCGGGGGG + Intergenic
1132583020 16:694039-694061 TGTGCGTGCGTGCGTGGGGCGGG + Exonic
1132649748 16:1015091-1015113 TGCGTGTGTGTGTCTGGGGGTGG - Intergenic
1132659370 16:1054650-1054672 TTTGTGTGTGTGGGTGGGGGTGG - Intergenic
1132668541 16:1093390-1093412 TGTGTGTGTGTGGGTGGGTGTGG - Intronic
1132668549 16:1093420-1093442 TGTGTGTGTGTGTGTGGGGGTGG - Intronic
1132814454 16:1819087-1819109 TGTTCGAGTGTGGGTGGGGGCGG - Intronic
1132866903 16:2097560-2097582 TGTCCGTGCGTGACTGGACGGGG - Intronic
1133612864 16:7449715-7449737 TGTGTGTGTGTGTGTGGGGGGGG + Intronic
1133612868 16:7449719-7449741 TGTGTGTGTGTGGGGGGGGGGGG + Intronic
1133715118 16:8440428-8440450 TGTGTGTGTGTGGGGGGGGGGGG - Intergenic
1133715122 16:8440432-8440454 TGTGTGTGTGTGTGTGGGGGGGG - Intergenic
1134524861 16:14935543-14935565 TGTCCGTGCGTGACTGGACGGGG + Intronic
1134548037 16:15125382-15125404 TGTCCGTGCGTGACTGGACGGGG - Intronic
1134644909 16:15858200-15858222 TGTGCGTGCGTGGACAGGAGCGG - Intergenic
1134712450 16:16334030-16334052 TGTCCGTGCGTGACTGGACGGGG + Intergenic
1134720315 16:16377342-16377364 TGTCCGTGCGTGACTGGACGGGG + Intergenic
1134947112 16:18334543-18334565 TGTCCGTGCGTGACTGGACGGGG - Intronic
1134954377 16:18374664-18374686 TGTCCGTGCGTGACTGGACGGGG - Intergenic
1136253921 16:29025568-29025590 TGTGGCTGGGTGACTGGGGGAGG - Intergenic
1136505315 16:30699041-30699063 CGCGCGTGCGCGGCTGGAGGCGG - Intronic
1136637833 16:31537208-31537230 TGTGTGTGTGTGTGTGGGGGGGG + Intergenic
1137001653 16:35234853-35234875 TCTGGGTGGCTGGCTGGGGGTGG - Intergenic
1137075045 16:35951516-35951538 TGTGTGTGTGTGTGTGGGGGGGG + Intergenic
1137400189 16:48146957-48146979 TGTGTGTGCGTGGGTGTGTGTGG - Intronic
1137561121 16:49503061-49503083 TGTGTGTGTGTTTCTGGGGGGGG - Intronic
1137867073 16:51909747-51909769 TGTGTGTTGGTGGCGGGGGGGGG + Intergenic
1137908293 16:52349180-52349202 TGTGTGTGTGTGGCAGGGTGGGG - Intergenic
1138178922 16:54929652-54929674 AGTGCGTCCGTGGCTTGTGGTGG + Intergenic
1138314932 16:56061742-56061764 TGTGCGTTCTTGGCTGGGCATGG + Intergenic
1138691743 16:58775273-58775295 TGTGTGTGTGTGTGTGGGGGGGG + Intergenic
1138691747 16:58775277-58775299 TGTGTGTGTGTGGGGGGGGGGGG + Intergenic
1138804235 16:60075588-60075610 TGGGGGTGGGAGGCTGGGGGAGG - Intergenic
1139602292 16:67993935-67993957 TGTGCGGTCGGGGCGGGGGGCGG - Intronic
1140022047 16:71247956-71247978 CCTGTGTGCGTGGCAGGGGGAGG + Intergenic
1140146884 16:72319832-72319854 TGTGTGTGTGTGTTTGGGGGGGG + Intergenic
1140796339 16:78441979-78442001 TGTGTGTGTGTGGCTGGGCATGG + Intronic
1140836984 16:78803908-78803930 GGTGTGTGTGTGGGTGGGGGAGG + Intronic
1141305586 16:82860374-82860396 TGTGTGTGTGTGTGTGGGGGGGG + Intronic
1141389445 16:83652420-83652442 TGTGAGTGCCATGCTGGGGGTGG + Intronic
1141405772 16:83791520-83791542 TATGCATGCCTGGCTGGGTGGGG + Intronic
1141601153 16:85127154-85127176 TGTGGGTGGGTGGAAGGGGGTGG - Intergenic
1141620750 16:85235562-85235584 TGTGTGTGTGTGGGTGGGGGGGG + Intergenic
1141688600 16:85584140-85584162 TGTGCGTGCGTGCCGGTGCGTGG + Intergenic
1141689296 16:85587444-85587466 TGTGCATGTGAGGCTGTGGGTGG + Intergenic
1141775153 16:86117996-86118018 TGTGAGTGCGTGTCGGGGCGAGG + Intergenic
1141786117 16:86201894-86201916 GCTGGGTGGGTGGCTGGGGGAGG + Intergenic
1142119746 16:88380878-88380900 TGTGAGTGCATGTCTGGGTGAGG - Intergenic
1142172606 16:88630754-88630776 TGTGTGTGTGTGGGGGGGGGTGG - Intronic
1142227052 16:88882645-88882667 TGTGTGGGCGTGGCTGTGTGTGG + Intronic
1203095538 16_KI270728v1_random:1252695-1252717 TCTGCGTGTGTGTGTGGGGGGGG + Intergenic
1142518359 17:447985-448007 TGTGTGTGTGTGGCAGGGGAGGG + Intergenic
1142621805 17:1169993-1170015 TGTGTGTGTGTGTGTGGGGGGGG + Intronic
1142753022 17:1999674-1999696 TGTGCGTGTGTGTGTGGGGGGGG - Intronic
1142761510 17:2044686-2044708 TGTGTGTGTGTGTCAGGGGGTGG - Intergenic
1143077569 17:4357494-4357516 TGTGTGTGTGTGTGTGGGGGGGG + Intronic
1143077573 17:4357498-4357520 TGTGTGTGTGTGGGGGGGGGGGG + Intronic
1143143243 17:4755175-4755197 TGGGAGTGCGTGGCTGAGGTGGG - Intergenic
1143287990 17:5805443-5805465 TGTGGGTGTGTGTCGGGGGGTGG + Intronic
1143315078 17:6026383-6026405 TGTGCATGTGTGGCTGGGGCAGG + Intronic
1143353796 17:6309380-6309402 TGTGTGTGTGTGGGGGGGGGGGG - Intergenic
1143353800 17:6309384-6309406 TGTGTGTGTGTGTGTGGGGGGGG - Intergenic
1143507593 17:7377123-7377145 TGTGTGTGTGTGGGTGGGGGCGG + Intergenic
1143532503 17:7513453-7513475 AGTGGGTGAGTAGCTGGGGGAGG - Exonic
1143591539 17:7888186-7888208 TGTGCGTGTGTGCAGGGGGGTGG - Intronic
1143739968 17:8945342-8945364 TGTGTGTGTGTGGCTGGGGTGGG - Intronic
1143793613 17:9318263-9318285 GGTGGGTGGGGGGCTGGGGGAGG - Intronic
1143848621 17:9792432-9792454 TGTGTGTGCGTATGTGGGGGGGG + Intronic
1143997455 17:11019604-11019626 TGTGTGTGTGTGGTGGGGGGTGG + Intergenic
1144591885 17:16531339-16531361 TGTGTGTGTGTGTGTGGGGGTGG - Intergenic
1145014548 17:19387714-19387736 TGTGGGAGCCTGGCTGGGGCTGG + Intergenic
1145166651 17:20617734-20617756 TGTGCATCTGTGGCTGGGGTGGG + Intergenic
1145318693 17:21750225-21750247 TGTGCGTGCCAGGCTGGCCGGGG + Intergenic
1145982371 17:29020538-29020560 TGTGCGTGTGTTGGTGGGGCAGG + Intronic
1146157918 17:30539541-30539563 TGTGTGTGTGTGGTGGGGGGGGG - Intergenic
1146271168 17:31486977-31486999 TGTGCATGTGTGGGTGTGGGTGG + Intronic
1146613276 17:34327734-34327756 TGTGTGTGCGTGTGTGTGGGGGG + Intergenic
1146649926 17:34600452-34600474 TGTGTGTGTGTGGCAGGGTGGGG + Intronic
1146714550 17:35073763-35073785 TGTGCGTGTGTGTCTGTGTGTGG - Intronic
1146723913 17:35142234-35142256 TGGGTGTGCGTGGATGGGGGCGG - Intronic
1146875926 17:36410654-36410676 TGTGTGTGTGTGTGTGGGGGGGG + Intronic
1147063456 17:37902214-37902236 TGTGTGTGTGTGGGGGGGGGGGG - Intergenic
1147063460 17:37902218-37902240 TGTGTGTGTGTGTGTGGGGGGGG - Intergenic
1147161629 17:38572353-38572375 TGTGTGTGGGTGGGTGGGTGGGG + Intronic
1147442016 17:40453204-40453226 TGTGGGTGCGTGCATGTGGGGGG - Intronic
1147455220 17:40533578-40533600 TGTGTGTGTGTGTCTCGGGGTGG + Intergenic
1147627385 17:41908961-41908983 TGGGTGTGCTTGGCTGGGAGGGG - Intronic
1147764610 17:42825085-42825107 TGTGTGTGTGTGGGGGGGGGGGG - Intronic
1148039302 17:44693759-44693781 TGGGCGTGGTTGGCTGGGCGCGG + Intergenic
1148046896 17:44749880-44749902 GGAGCGTGGGGGGCTGGGGGAGG - Intronic
1148483320 17:47974742-47974764 TGGGGGTGCGGGGGTGGGGGTGG - Intronic
1148542549 17:48492307-48492329 GGTGGGTGGGGGGCTGGGGGTGG - Intergenic
1148695963 17:49558436-49558458 TGTGTGTGTGTGGGGGGGGGGGG - Intergenic
1148695967 17:49558440-49558462 TGTGTGTGTGTGTGTGGGGGGGG - Intergenic
1148981745 17:51582530-51582552 TGTGGGTGGGTGGGTGGGTGGGG + Intergenic
1149045526 17:52240306-52240328 TGTGCGTGTGTGGGTGCGAGGGG + Intergenic
1149235692 17:54588183-54588205 CGGGGGTGGGTGGCTGGGGGAGG - Intergenic
1149253789 17:54801031-54801053 AGTGGGTGGGGGGCTGGGGGGGG + Intergenic
1149495041 17:57112141-57112163 TGTGGGTGCTTGGTTGGGCGGGG + Intronic
1149737224 17:59007217-59007239 TGTGTGTGGGTGGGTGGGGGTGG - Intronic
1149737226 17:59007221-59007243 TGTGTGTGTGTGGGTGGGTGGGG - Intronic
1150005070 17:61464141-61464163 TGTGCGTGCCTGGAGGGAGGAGG - Intronic
1150064739 17:62099587-62099609 TGTGTGTGTGTGGGTGTGGGTGG + Intergenic
1150250537 17:63702007-63702029 TGTGTGTGTGTGGGGGGGGGAGG + Intergenic
1150485147 17:65538050-65538072 TGTGGGTGTGTGCCTGGGCGTGG - Intronic
1151009360 17:70475595-70475617 TGTGTGTGTGTGACTGGAGGTGG + Intergenic
1151313903 17:73310733-73310755 TGTGTGTGTGTGACTGGGGGAGG - Intronic
1151419803 17:73989820-73989842 TGTGTGTGGGTTGCTGGGGTAGG - Intergenic
1151655692 17:75494990-75495012 GGAGCCTGCGTGGCTGGGGCTGG - Exonic
1151708400 17:75784999-75785021 CGTGCGCGCGCGGCGGGGGGGGG - Intronic
1151916721 17:77123701-77123723 TGGGCCTGGGTGGCTGGGTGTGG - Intronic
1152000259 17:77640892-77640914 TGTGCGTGTGTGGGCGGTGGTGG + Intergenic
1152025211 17:77804563-77804585 TGTGTGTGTGTGGGTGGCGGTGG - Intergenic
1152053388 17:78000620-78000642 TGTGTGTGTGTGGGGGGGGGGGG - Intergenic
1152070204 17:78130571-78130593 TGTGCATGCTGGGCTGCGGGTGG - Intronic
1152070429 17:78131470-78131492 TGTGCACGCTGGGCTGGGGGCGG - Exonic
1152077732 17:78169263-78169285 TGTGTGTGTGTGGCGGGGAGGGG + Intronic
1152235925 17:79138715-79138737 TGTGCATGCGTGTGTGGGTGAGG - Intronic
1152235968 17:79139022-79139044 TGTGCGTGCGTGTGTGGGTGAGG - Intronic
1152235977 17:79139102-79139124 TGTGCGTGTGTGGGTGAGAGTGG - Intronic
1152238088 17:79148806-79148828 TCTGCGGGCCTGGCTGGGGTAGG + Intronic
1152339215 17:79715178-79715200 TGTGTGTGTGTGGCGGGGAGGGG - Intergenic
1152466656 17:80470459-80470481 TGTGCGTGCGTGGCTGGGGGAGG - Exonic
1152721484 17:81926017-81926039 TGTGTGTGTGTGGCGGGGGGCGG + Intronic
1152733470 17:81985044-81985066 TGTGCGTGGGTGTGTGTGGGGGG - Intronic
1152756634 17:82089769-82089791 GGTGGGTGGGTGGCTGGGAGCGG - Intronic
1153378448 18:4408266-4408288 TGTGGGTGTGTTGCAGGGGGTGG + Intronic
1153538544 18:6130250-6130272 TGTGTGTGTGTGGCGGGTGGGGG - Intronic
1153844768 18:9039305-9039327 TGTGTGTGTGTGGCGGGGCGGGG - Intergenic
1153986172 18:10352702-10352724 TGTGTGTGCATGGCAGGGGTTGG + Intergenic
1154354219 18:13612548-13612570 TGTGTGAGCGTGGAGGGGGGGGG - Intronic
1155116574 18:22774153-22774175 TGTGCGTGTGTGTGTGGGGGGGG + Intergenic
1155297327 18:24397547-24397569 TGTCCGCGCCTGGTTGGGGGTGG - Intronic
1156280043 18:35628001-35628023 TGTGGCAGCGAGGCTGGGGGAGG + Intronic
1156568528 18:38223875-38223897 TGTGTGTGTGTGGCTGGGGGAGG - Intergenic
1156649662 18:39210379-39210401 TGTGGGTGGGTGGGTGGGTGTGG + Intergenic
1156765157 18:40644307-40644329 TGTGTGTGTGTGTCGGGGGGTGG + Intergenic
1157072934 18:44431023-44431045 TGCGGGTGGGAGGCTGGGGGAGG - Intergenic
1157142456 18:45123392-45123414 TGTGTGTGTGTGGCGGGGGCAGG + Intergenic
1157184624 18:45528174-45528196 TGTGTGTGCGGGGGGGGGGGGGG + Intronic
1157303620 18:46499669-46499691 TGTGTGTGTGTGGCAGGGGGAGG + Intronic
1157313408 18:46569337-46569359 TGTGCGTGTGTGTCTGTGTGTGG + Intronic
1157352914 18:46906763-46906785 TGTGTGTGTGTGGGGGGGGGGGG + Intronic
1157795206 18:50567743-50567765 TGTGTGTGTGTGGGTGGGTGTGG + Intronic
1157909666 18:51603992-51604014 TGTGTGTGTGTGGCAGGGGATGG + Intergenic
1158004141 18:52652729-52652751 TGTGTGTGTGTGGGTGGAGGAGG + Intronic
1158109168 18:53920792-53920814 TGTGTGTGTGTGCATGGGGGCGG + Intergenic
1158372841 18:56829286-56829308 TGTGTGTGTGTGGTAGGGGGAGG - Intronic
1158620944 18:59032058-59032080 TGGGAGTGCGGGGTTGGGGGCGG - Intergenic
1159363121 18:67430744-67430766 TGTGTGTGTGTGTATGGGGGGGG + Intergenic
1160120612 18:76127519-76127541 AGTGGGTGCATGGTTGGGGGAGG - Intergenic
1160499805 18:79396057-79396079 TGTGCGCGCGTGGCGGGGCCCGG - Intronic
1160635924 19:75277-75299 AGTGGGTGGGGGGCTGGGGGAGG - Intergenic
1160786101 19:900807-900829 GGTGCGGGCCTGGCTGGGGCGGG - Exonic
1160874080 19:1289344-1289366 TGTGTGTGCGTGTCTGCGTGTGG + Intronic
1160966048 19:1747407-1747429 TGTGTGTGTGTGGCGGGCGGTGG - Intergenic
1161015000 19:1979100-1979122 TGCGCGCGCGCGGCGGGGGGCGG + Intronic
1161050899 19:2163773-2163795 CGTGCGTGCGTGGATTCGGGCGG + Intronic
1161062834 19:2223553-2223575 TGTGTGTGGGTGGGTGGGTGGGG + Intronic
1161453870 19:4360803-4360825 TGGGTGTGGGTGGCTGGTGGTGG + Exonic
1161473799 19:4473675-4473697 TCTGAGTGAGGGGCTGGGGGTGG + Intronic
1161581100 19:5081530-5081552 GAGGCGTGCGTGGCTGGGGTGGG - Intronic
1161952915 19:7477607-7477629 TGTTCGTGCTTGGGTCGGGGGGG - Intronic
1162116887 19:8435855-8435877 TGTGTGTGTGTGGCGGGGAGGGG + Intronic
1162336215 19:10062060-10062082 TGTGTGTGTGTGTGTGGGGGGGG + Intergenic
1162336219 19:10062064-10062086 TGTGTGTGTGTGGGGGGGGGGGG + Intergenic
1162342991 19:10102950-10102972 GGTGTGTGCGTGTCTGGGGCTGG - Intergenic
1162499552 19:11044185-11044207 GGTGTGTGCGTGTGTGGGGGTGG - Intronic
1162783874 19:13022292-13022314 GGAGTGTGCGTGGCTGGGTGTGG + Intronic
1163228212 19:15979759-15979781 TGTGGGTGGGTGGCTTGGGTGGG + Intergenic
1163439977 19:17317547-17317569 TGTGAGGGTGTGGCTGGGTGTGG + Intronic
1163631425 19:18419707-18419729 AGTGAGTGCGGGGCCGGGGGCGG + Exonic
1163735723 19:18979238-18979260 TGAGCCTGGGTGGCTGGGAGTGG + Intergenic
1164137464 19:22427659-22427681 TGTGGCTGCCAGGCTGGGGGTGG + Intronic
1164459724 19:28436523-28436545 TGTGCGTGCCGGGCAGGTGGTGG - Intergenic
1164495060 19:28753076-28753098 GGTGGGTGGGGGGCTGGGGGAGG + Intergenic
1164693676 19:30228055-30228077 TGTGCGTGCGTGTGTGTGTGTGG + Intergenic
1164735640 19:30539121-30539143 TGTGCGTGTGTGTGTGTGGGGGG - Intronic
1164800433 19:31071648-31071670 TGTGTGTGTGTGTCGGGGGGTGG + Intergenic
1164886825 19:31785408-31785430 TGTGTGTGGGTGTCTGGGTGTGG + Intergenic
1164952699 19:32351460-32351482 TGTGTGTGTGTGGCGTGGGGGGG + Intronic
1165093353 19:33397696-33397718 GGTGGGAGCGGGGCTGGGGGAGG + Intronic
1165504186 19:36214494-36214516 TGTGGCTGTGTGGCTGGGTGTGG - Intronic
1165591594 19:36973695-36973717 TGTGCCTGCGGGGCTGTGGTGGG + Intronic
1165716189 19:38047220-38047242 TGTGCGTGCGTGTGTGTCGGCGG - Intronic
1165928080 19:39339701-39339723 TGTGTGTGTGTGGGGGGGGGGGG - Intronic
1165928084 19:39339705-39339727 TGTGTGTGTGTGTGTGGGGGGGG - Intronic
1165929012 19:39343983-39344005 TGTGTGTGTGTGGGGGGGGGGGG - Intronic
1166333113 19:42090058-42090080 TGTGCGTGCGTGCATGTGGGGGG + Exonic
1166564434 19:43754976-43754998 TGAGCGTGCGTGGATGGAGGCGG + Exonic
1166799984 19:45450894-45450916 TGCGCGGGCGTGGGGGGGGGGGG - Intronic
1166928279 19:46284663-46284685 TGTGAGTGCTGGGCTGGGTGTGG - Intergenic
1167103462 19:47417917-47417939 TGTGCATGTGTGTGTGGGGGGGG - Intronic
1167308308 19:48721321-48721343 GGTGGGTGGGTGGCTGGTGGAGG + Intronic
1167470988 19:49676441-49676463 TGGGCGTTCCTGGCAGGGGGAGG + Intronic
1167595205 19:50423757-50423779 TATGCGGGAGTGGCTGGGGTGGG + Intronic
1167794662 19:51701747-51701769 TGTGTGTGTGTGTCTGGGGAAGG - Intergenic
1167825853 19:51972363-51972385 TGTGTGTGTGTGGCGGGGGTGGG - Intronic
1168114055 19:54211122-54211144 TGTGTGTGTGTGGCAGGGGGTGG + Intronic
1168162486 19:54520800-54520822 TGTGTGTGTGTGTCTGGGGAGGG + Intergenic
1202679257 1_KI270711v1_random:36938-36960 TGTGTGTGTGTGGGTGGGTGTGG - Intergenic
925020247 2:562925-562947 TGGGCCTGCGGGGCTGTGGGGGG + Intergenic
925088918 2:1137266-1137288 TGTGCATGCGTGGGTGTGGGCGG - Intronic
925088932 2:1137412-1137434 TGTGCATGTGTGGGTGTGGGTGG - Intronic
925130873 2:1493195-1493217 TGTGTGTGAGTGGGTGGGGGGGG + Intronic
925371566 2:3349325-3349347 GGTGGGTGAGTGGCTGGAGGAGG - Intronic
925410499 2:3637136-3637158 TGTGGGTGCGTGGTTTGGTGGGG + Intronic
925413112 2:3651299-3651321 GGTGGGTGGGTGGGTGGGGGGGG + Intergenic
925927988 2:8684531-8684553 TGTGTGTGTGTGTGTGGGGGGGG - Intergenic
926087616 2:10029779-10029801 TGTGTGTGTGTGGCGGGGGTGGG - Intergenic
926111484 2:10187003-10187025 GGTGCGTGCGGGGCTGGTGCCGG + Intronic
926286438 2:11492601-11492623 TGTGAGTGCATGAATGGGGGTGG + Intergenic
926335946 2:11862949-11862971 TGTGTGTGTGTGTCGGGGGGTGG + Intergenic
926997796 2:18757071-18757093 TGTGGGTGGGTGGGTGGGTGGGG + Intergenic
926997798 2:18757075-18757097 GGTGGGTGGGTGGGTGGGGGTGG + Intergenic
927011795 2:18911781-18911803 TGTGTGTGTGTTGGTGGGGGTGG + Intergenic
927207526 2:20619461-20619483 TGTGCCTGCTTTGCTGTGGGTGG - Intronic
927472563 2:23386422-23386444 TGTGCGTGTGTGTGTCGGGGTGG - Intronic
927475591 2:23412109-23412131 TGTGTGTGCGTGAAGGGGGGGGG + Intronic
927728518 2:25448333-25448355 TGTGTGTGGCTGGTTGGGGGTGG + Intronic
927848255 2:26483208-26483230 TGTGTGTGCGTGCCTGTGTGTGG + Intronic
928688382 2:33773683-33773705 TGTGTGTGGGTGGCGGGGGGTGG + Intergenic
928887549 2:36167371-36167393 TGTGTGTGTGTGGGGGGGGGGGG - Intergenic
928887553 2:36167375-36167397 TGTGTGTGTGTGTGTGGGGGGGG - Intergenic
929072145 2:38042393-38042415 TGTGTGTGTGTGGCGGGGGGAGG - Intronic
929075705 2:38077159-38077181 TGTGCGTGCGCAGCCGAGGGTGG - Intronic
929305705 2:40358972-40358994 GGTGCGGGGGTGGATGGGGGTGG + Intronic
929369477 2:41204851-41204873 TGTACGTGCGTGTATGTGGGGGG + Intergenic
929465593 2:42141065-42141087 TATGCCTGTGTGGCTGGGCGTGG - Intergenic
930153575 2:48082235-48082257 TGTGTGTGTGTGTCTGGTGGGGG - Intergenic
930641616 2:53859612-53859634 GGTGGGTGGGTGGGTGGGGGGGG + Intronic
930673845 2:54179243-54179265 GGTGGGTGGGTGGGTGGGGGAGG + Intronic
932080657 2:68711661-68711683 GGGGGGTGGGTGGCTGGGGGAGG - Intronic
932156546 2:69423198-69423220 TGTGTGTGTGTGGGGGGGGGCGG + Intronic
932557021 2:72833470-72833492 TGTGTGTGACTGGCTGGGGCAGG - Intergenic
932627641 2:73311101-73311123 TGTACGTGTGTGTATGGGGGGGG + Intergenic
932658366 2:73629994-73630016 TGTGTGTGTGTGGGGGGGGGGGG - Intergenic
932658370 2:73629998-73630020 TGTGTGTGTGTGTGTGGGGGGGG - Intergenic
932776355 2:74530312-74530334 TTCGCGCGCGTGGCTGGCGGTGG + Exonic
933112245 2:78417677-78417699 TGTGTGTGTGTGGCTGTGGAGGG + Intergenic
933801559 2:85964211-85964233 TGTGGCAGCGAGGCTGGGGGAGG + Intergenic
934168791 2:89321683-89321705 TGTGTGTGTGTGTGTGGGGGGGG + Intergenic
934896959 2:98127579-98127601 TGTGTGTGTGTGGGCGGGGGGGG + Intronic
934955235 2:98611979-98612001 TGTGTGTGTGTGGCGGTGGGGGG - Intronic
934962977 2:98694080-98694102 GGTGGGTGGGTGGCTGGGGCTGG - Intronic
935354058 2:102181771-102181793 TGTGTGTGTGTGTGTGGGGGGGG + Intergenic
935354060 2:102181775-102181797 TGTGTGTGTGTGGGGGGGGGCGG + Intergenic
935591621 2:104850821-104850843 TGTGCCTGCCTGGATTGGGGTGG - Intergenic
936321098 2:111467750-111467772 TGTGTGTGTGTGGGGGGGGGGGG + Intergenic
936565556 2:113579775-113579797 AGTGGGTGGGGGGCTGGGGGAGG + Intergenic
936593654 2:113827248-113827270 GGTGGGTGGGGGGCTGGGGGAGG + Intergenic
936653311 2:114455175-114455197 TGTGTGTGTGTGTTTGGGGGTGG + Intronic
936911730 2:117600748-117600770 AGTGGGTGGGGGGCTGGGGGAGG + Intergenic
937000866 2:118466483-118466505 TGTGTGTGTGTGGTGGGGGGAGG - Intergenic
937045285 2:118848018-118848040 GGTGCGGGCGCGGGTGGGGGAGG - Intergenic
937132256 2:119522757-119522779 TGTTATTCCGTGGCTGGGGGTGG - Intronic
937246139 2:120495199-120495221 TGTGTGTGTGTGGGGGGGGGAGG - Intergenic
937390173 2:121479050-121479072 TGTGTGTGTGTGTGTGGGGGGGG - Intronic
937624195 2:124025214-124025236 GGGGCGGGCCTGGCTGGGGGCGG + Intergenic
937681962 2:124653915-124653937 TGTGTGTGTGTGGCGGGGGGGGG - Intronic
937856409 2:126674785-126674807 TGTGTGTGTGTGGCAGGGGTGGG - Intronic
937866224 2:126753417-126753439 TGTGAGTGTGGGGCTGGGGATGG + Intergenic
938230823 2:129657307-129657329 TGTGTGTGTGTGGCGGGGGAGGG - Intergenic
938372993 2:130785493-130785515 TTTGGGTGGGTGGGTGGGGGTGG - Intergenic
938397632 2:130963053-130963075 TGTGTGTGCGAGGTAGGGGGTGG - Intronic
938557312 2:132437428-132437450 TGTGTGTGATTGGCTGGGGAGGG + Intronic
939340058 2:140883677-140883699 TGTGTGTGTGTGGCGGGGGCGGG - Intronic
939710924 2:145519277-145519299 TGGGAGTGGGAGGCTGGGGGAGG - Intergenic
939765141 2:146238994-146239016 TGTGTGTGTGTGGCTGGTGGAGG - Intergenic
939939325 2:148330044-148330066 TGTGTGTGTGTGTGTGGGGGGGG - Intronic
939970679 2:148656010-148656032 TGTGTGTGTGTGTGTGGGGGGGG + Intronic
939970683 2:148656014-148656036 TGTGTGTGTGTGGGGGGGGGGGG + Intronic
939979186 2:148758159-148758181 TGTGGGTGGGTGGGTGGGTGTGG + Intronic
940375546 2:152954187-152954209 TGTGTGTGTGTGGGTTGGGGGGG + Intergenic
940670120 2:156657183-156657205 TGTGTGTGTGTGGTTGGAGGTGG + Intergenic
941697990 2:168573739-168573761 TCTCTGTGGGTGGCTGGGGGTGG + Intronic
942005934 2:171699623-171699645 TGTGTGTGTGTGGCGGCGGGCGG + Intronic
942453336 2:176122057-176122079 TGTGTGAGTGTGGCAGGGGGAGG + Intergenic
942970674 2:181954253-181954275 TGTGTGTGTGTGGCGGGAGGCGG - Intronic
943446428 2:187993565-187993587 TGTGTGTGTGTGGGTCGGGGTGG - Intergenic
945020042 2:205561409-205561431 TGTGAGTGCTTGTCTGGGTGTGG + Intronic
945207025 2:207343166-207343188 TGTGTGTGTGTGCCTGGTGGGGG + Intergenic
945888912 2:215407944-215407966 TGTGTGTGTGTGGCGGGGGTGGG - Intronic
945984958 2:216346250-216346272 CGTGTGTGGGTGGGTGGGGGTGG - Intronic
945984960 2:216346254-216346276 TGTGCGTGTGTGGGTGGGTGGGG - Intronic
946244899 2:218381934-218381956 TGTGTGTGTGTGGCAGAGGGGGG + Intergenic
946329634 2:219002022-219002044 TGAGTGTGTGTGTCTGGGGGCGG - Intergenic
946592956 2:221271736-221271758 TGTGTGTGCATGGCAGGGGCTGG - Intergenic
947150248 2:227108116-227108138 TGGGTGTGAGTGGCAGGGGGAGG + Intronic
947333444 2:229054705-229054727 TGTGTGTGTGTGTGTGGGGGGGG + Intronic
947333448 2:229054709-229054731 TGTGTGTGTGTGGGGGGGGGGGG + Intronic
947385448 2:229586426-229586448 TGTGTGTGGGTGGGTGGGTGGGG - Intronic
947391216 2:229641507-229641529 TGTGTGTGTGGGGCGGGGGGAGG - Intronic
947958973 2:234218683-234218705 TGTGCGCGCGTGTTTGGGGTGGG + Intergenic
947991881 2:234495314-234495336 TGTGCTGGCCTGGCTGGGGATGG - Exonic
948211130 2:236193922-236193944 TGTGTGTGGGTGGGTGGGTGTGG + Intergenic
948264225 2:236625585-236625607 TGTGTGTGTGTGGGGGGGGGCGG + Intergenic
948525121 2:238566707-238566729 TGAGCTGGCCTGGCTGGGGGCGG - Intergenic
948702126 2:239767057-239767079 TGTGCCTGCAGGGCTGGGGGAGG + Intronic
948795176 2:240398951-240398973 TGAGCGTGTGGGGCTGGTGGGGG + Intergenic
948837374 2:240632176-240632198 TGTCCATGCCTGGTTGGGGGGGG + Intergenic
1170230152 20:14037630-14037652 TGTGTGTGTGTTGGTGGGGGGGG + Intronic
1170756361 20:19210512-19210534 TGTGTGTGTGTGGCGGGGTGGGG - Intergenic
1170866420 20:20161861-20161883 TGAGAGGGCGTGGCTGGAGGAGG - Intronic
1171117279 20:22535816-22535838 TGAGCGTGGGAGGCTGGAGGGGG - Intergenic
1171767507 20:29298088-29298110 TGTGTGTGCGTGTCGTGGGGTGG - Intergenic
1171811778 20:29750395-29750417 TGTGCGTGGGTTGCGGGGTGGGG + Intergenic
1171867348 20:30497202-30497224 TGTGCGTGGGTTGCGGGGTGGGG + Intergenic
1171896948 20:30816305-30816327 CGTGCGGGCGTGGCTGGGCCCGG - Intergenic
1171907895 20:30915313-30915335 TGTGCGTGGGTTGCGGGGTGGGG - Intergenic
1171969976 20:31558303-31558325 TGGCAGTGCGTGGCTGGAGGGGG - Intronic
1172587221 20:36093164-36093186 GGTGCGTGCGTATCTGGGTGAGG + Intronic
1172618606 20:36306143-36306165 TGCGGGGGCGTGGGTGGGGGTGG + Intergenic
1172778593 20:37422677-37422699 TGTGTGTGTGTGTGTGGGGGGGG + Intergenic
1172793579 20:37522564-37522586 TGGGCGGGCGGGGCAGGGGGTGG + Intronic
1172842004 20:37907643-37907665 TGTGTGTGTGTGGCAGGGTGGGG - Intronic
1173369432 20:42421549-42421571 TGTGTGTGTGTGTTTGGGGGAGG + Intronic
1173653773 20:44684770-44684792 TGTGTGTGTGTGGGGGGGGGAGG + Intergenic
1173880869 20:46411269-46411291 TGTGTGTGTGTGTGTGGGGGGGG + Intronic
1173881081 20:46412701-46412723 TGTGTGTGTGTGTGTGGGGGGGG + Intronic
1174080551 20:47968384-47968406 TGTGTGTGTGTGGGGGGGGGGGG - Intergenic
1174306062 20:49615068-49615090 TGTGTGTGTGTGTGTGGGGGGGG + Intergenic
1174306066 20:49615072-49615094 TGTGTGTGTGTGGGGGGGGGGGG + Intergenic
1174390141 20:50213930-50213952 TGTGTGTGTGTGGCAGGGGTGGG + Intergenic
1175080400 20:56415331-56415353 ACTGCGTGGGTGGGTGGGGGTGG - Intronic
1175597654 20:60248139-60248161 TGTGTGTGTGTGGGAGGGGGGGG - Intergenic
1175787718 20:61722630-61722652 TGTGCATGCGTGGGGGGTGGGGG - Intronic
1176043876 20:63082574-63082596 TGTGCATGGGTGCTTGGGGGCGG + Intergenic
1176097396 20:63350396-63350418 TGTGCGTGCGTGGCGAGCGGTGG + Exonic
1176282258 20:64320299-64320321 TGTGTGTGCCGGGGTGGGGGTGG - Intergenic
1176430517 21:6572713-6572735 TGTGTGTGTGTGTGTGGGGGGGG + Intergenic
1176549303 21:8214501-8214523 TGGGCGGGCGGGGCCGGGGGTGG + Intergenic
1176557196 21:8258724-8258746 TGGGCGGGCGGGGCCGGGGGTGG + Intergenic
1176568235 21:8397539-8397561 TGGGCGGGCGGGGCCGGGGGTGG + Intergenic
1176576138 21:8441759-8441781 TGGGCGGGCGGGGCCGGGGGTGG + Intergenic
1176920209 21:14679149-14679171 TGTGGGTGTGTGGGTAGGGGTGG - Intergenic
1177181999 21:17754258-17754280 TGTGTGTGTGTGTCTGGAGGAGG + Intergenic
1177855344 21:26394506-26394528 TGTGTGTGCGTGCATGGTGGTGG + Intergenic
1178021845 21:28417254-28417276 TGTGTGTGTGTGGGGGGGGGGGG - Intergenic
1178494481 21:33075427-33075449 TGTGTGTGGGGGGGTGGGGGTGG + Intergenic
1178837864 21:36113665-36113687 TGTGTGTGTGTGGGGGGGGGGGG - Intergenic
1178837868 21:36113669-36113691 TGTGTGTGTGTGTGTGGGGGGGG - Intergenic
1178888369 21:36499940-36499962 TCTGTGTGCGCGGCTGGGGCAGG - Intronic
1179256009 21:39715890-39715912 TGTGGGGGGGTGGCTGGGGAGGG + Intergenic
1179428658 21:41303874-41303896 TGTGTGTGTGTGGCAGGGGGGGG + Intergenic
1179478975 21:41665906-41665928 AGTGGGTGGGTGGCGGGGGGAGG + Intergenic
1179674812 21:42974367-42974389 GGTGCGGGCGGGGCTGGAGGCGG + Intergenic
1179680591 21:43018460-43018482 TGTGTGTGGGTGGCAGGGGGTGG - Intronic
1179705911 21:43180175-43180197 TGTGTGTGTGTGTGTGGGGGGGG + Intergenic
1179708424 21:43195582-43195604 TGTGCGGGGGAGGCCGGGGGAGG + Intergenic
1179772406 21:43632050-43632072 TGTGGGAGCGTGTGTGGGGGGGG - Intronic
1179886493 21:44316339-44316361 CGTGCGTGTGGGCCTGGGGGTGG + Exonic
1180341338 22:11621483-11621505 TGTGCGTGGGTTGCGGGGTGGGG - Intergenic
1180785347 22:18543970-18543992 CGGGGGTGTGTGGCTGGGGGTGG + Intergenic
1180791267 22:18576976-18576998 TGTGCGTGGTTGGGGGGGGGGGG - Intergenic
1180791271 22:18576980-18577002 GGTGTGTGCGTGGTTGGGGGGGG - Intergenic
1180881023 22:19203645-19203667 TGGGGGTGTGGGGCTGGGGGGGG - Intronic
1180951722 22:19723476-19723498 GGTGCGGGCGTGGCAGGGGCGGG + Exonic
1181031116 22:20149279-20149301 GGTGGGTGCCAGGCTGGGGGTGG - Intronic
1181128929 22:20718011-20718033 CGGGGGTGTGTGGCTGGGGGTGG + Intronic
1181230466 22:21418331-21418353 GGTGTGTGCGTGGTTGGGGGGGG + Intronic
1181242251 22:21483323-21483345 CGGGGGTGTGTGGCTGGGGGTGG + Intergenic
1181248179 22:21516531-21516553 TGTGCGTGGTTGGGGGGGGGGGG - Intergenic
1181248183 22:21516535-21516557 GGTGTGTGCGTGGTTGGGGGGGG - Intergenic
1181476059 22:23168486-23168508 TGTGTGTGTGTGGCGGGGAGCGG - Intergenic
1181586787 22:23857063-23857085 TGTGTGTGTGTGGGGGGGGGGGG + Intronic
1181743972 22:24942928-24942950 TGTGTGTGTGTTGCTGGGGGAGG + Intronic
1181860786 22:25816485-25816507 TGGGGGTGGGGGGCTGGGGGAGG - Intronic
1181997157 22:26892045-26892067 TGTGTGTGTGGGGGTGGGGGTGG + Intergenic
1182243168 22:28933724-28933746 TGTGTGTGTGTGTGTGGGGGGGG - Intronic
1182391382 22:30000062-30000084 TGTAAGTGCGTTGGTGGGGGAGG + Intronic
1182784826 22:32898675-32898697 TGTGTGTGCATGTCTTGGGGAGG + Intronic
1183267497 22:36838187-36838209 TGTGTGTGTGTGGGGGGGGGGGG + Intergenic
1183415013 22:37676905-37676927 TGTCCGGGGGTGGCTGGGGGTGG - Intronic
1183723281 22:39574479-39574501 GGTGCGTGTGTGGGTGGGGCAGG + Intronic
1183794917 22:40108923-40108945 TGGGGGTGGGTGGCGGGGGGAGG - Intronic
1183990488 22:41594332-41594354 TGTGGGTGGGGGGGTGGGGGAGG + Intergenic
1184076193 22:42180008-42180030 TGTGGGTGGGTGGATGGCGGGGG - Intronic
1184101613 22:42344049-42344071 CGTGCGTGGGGGGCTGGGCGCGG - Intergenic
1184320194 22:43735737-43735759 TGTGTGTGTGTGGCAGGGGGAGG + Intronic
1184707713 22:46225833-46225855 TGTGTGTGCGTGTGTGGGGGTGG - Intronic
1184858388 22:47158871-47158893 TGTGTGTGTGTGGCCTGGGGAGG - Intronic
1184885888 22:47344199-47344221 TGTGTGTGTGAGGCTGGGAGAGG + Intergenic
1185048729 22:48542138-48542160 TGTGTGTGTGTGGGTGTGGGGGG + Intronic
1203254188 22_KI270733v1_random:130817-130839 TGGGCGGGCGGGGCCGGGGGTGG + Intergenic
1203262244 22_KI270733v1_random:175896-175918 TGGGCGGGCGGGGCCGGGGGTGG + Intergenic
949331847 3:2932040-2932062 TGTGTGTGTGTGGCCGGGGTGGG + Intronic
949337041 3:2986203-2986225 TGTGTTTGCGAGGCTGGGTGTGG - Intronic
949905668 3:8856353-8856375 TGTGTGTGCGTGTGTGTGGGGGG + Intronic
950438547 3:12994338-12994360 TGTGCGTGCGCGGCTGTGCTAGG + Intronic
950475474 3:13211842-13211864 TGTGCCTGCGAGGGTGGGCGAGG - Intergenic
950720504 3:14879264-14879286 TGTGCAGGCGTGGCTGGCAGCGG - Intronic
950903579 3:16517626-16517648 TGTGTGTGTGTGTGTGGGGGGGG + Intergenic
950903583 3:16517630-16517652 TGTGTGTGTGTGGGGGGGGGGGG + Intergenic
951363514 3:21752015-21752037 TGTGTGTGTGTGGTGGGGGGGGG - Intronic
951588433 3:24238264-24238286 TGTGTGTGTGTGTGTGGGGGGGG + Intronic
951588437 3:24238268-24238290 TGTGTGTGTGTGGGGGGGGGGGG + Intronic
951966456 3:28391343-28391365 TGTGTGTGTGTGGCAGGGAGAGG - Intronic
951984028 3:28598037-28598059 TGTGTGTGTGTGGGTGGGGGTGG + Intergenic
952132988 3:30385821-30385843 TGGGGGTGGGGGGCTGGGGGAGG - Intergenic
952632206 3:35482830-35482852 GGTGGGAGCGAGGCTGGGGGAGG - Intergenic
952643351 3:35625201-35625223 TGTGTGTGTGTGGTGGGGGGGGG - Intergenic
952740474 3:36729238-36729260 TGTGTGTGTGTGGGGGGGGGGGG + Intronic
953361160 3:42298069-42298091 TTTGACTGCATGGCTGGGGGGGG - Intergenic
953409791 3:42684306-42684328 TGTGTGTGTGTGTCTGGTGGTGG + Intergenic
953418570 3:42737055-42737077 GGTGGGTGGGGGGCTGGGGGAGG - Intronic
953444664 3:42952825-42952847 TGTGTGTGTGTGGGGGGGGGGGG - Intronic
953454072 3:43028553-43028575 TATGTGTGTGTGGGTGGGGGTGG + Intronic
953531224 3:43741347-43741369 TGTGTGTGTGTGGGCGGGGGGGG - Intergenic
954054761 3:48012660-48012682 TGAGAGTGTGTGGCTGGGGGCGG - Intronic
954577854 3:51686643-51686665 TGTGCTTGCCTGGCTGCGGTTGG + Intronic
954609563 3:51937170-51937192 TGTGAGTGAGTGCCTGGGTGGGG - Exonic
954978265 3:54717857-54717879 TGTGCGTGCGTGTGTGTGGTGGG + Intronic
955155037 3:56408462-56408484 TGTGTGTGTGTGTTTGGGGGAGG - Intronic
955421363 3:58741405-58741427 TGTGTGTGTGTGGCAGTGGGGGG + Intronic
955950184 3:64235926-64235948 TGTGTGTGTGTAGTTGGGGGAGG + Intronic
956146354 3:66194952-66194974 AGTGGGTGAGTGGCTGGGTGGGG - Intronic
956167719 3:66408951-66408973 TGTGTGTGTGTGGTGGGGGGAGG + Intronic
956252040 3:67244580-67244602 TGTGTGTGTGTGTATGGGGGTGG - Intergenic
956312518 3:67897023-67897045 TGTGTGTGTGTGTGTGGGGGGGG + Intergenic
956312522 3:67897027-67897049 TGTGTGTGTGTGGGGGGGGGGGG + Intergenic
956542625 3:70359032-70359054 TGTGTGTTGGGGGCTGGGGGTGG - Intergenic
956584808 3:70852969-70852991 TGGGCGTGCTGGGGTGGGGGTGG - Intergenic
956630140 3:71308796-71308818 TGTGTGTGTGTGGGTGAGGGGGG + Intronic
956673402 3:71712615-71712637 TGTGTGTGTGTTGCGGGGGGTGG + Intronic
956816700 3:72914594-72914616 TGTGCGTGTGTGTGAGGGGGTGG + Intronic
956886901 3:73569550-73569572 TGTGTGTGCGGGTGTGGGGGTGG - Intronic
957124911 3:76146715-76146737 TGTGTGTGTGTGTCTGGTGGAGG + Intronic
957192488 3:77027779-77027801 TGTGCGTGTGTGCCAGGGGAGGG + Intronic
957468363 3:80625187-80625209 TGTGCGTGTGTGTGTCGGGGGGG - Intergenic
957701163 3:83715130-83715152 TGTGTGTGTGTGGGTGCGGGGGG + Intergenic
958459694 3:94379270-94379292 TGTGTGTGTGTGGTTGGGGGTGG + Intergenic
959193219 3:103142225-103142247 GGGGCGTGCGGGGCTAGGGGAGG + Intergenic
959604514 3:108227435-108227457 TGGGGGTGGGTGGCGGGGGGCGG + Intergenic
959954998 3:112226719-112226741 TGTGTGTGGGGGGATGGGGGGGG - Intronic
960173103 3:114486123-114486145 TGTGTGTGTGTGTGTGGGGGGGG + Intronic
960173107 3:114486127-114486149 TGTGTGTGTGTGGGGGGGGGGGG + Intronic
960719828 3:120615256-120615278 GGTGAGTGGGGGGCTGGGGGCGG - Intergenic
961158613 3:124702762-124702784 TGTATGTGTGTGGCAGGGGGAGG - Intronic
961197409 3:125014515-125014537 TGTGTGTGGAGGGCTGGGGGTGG + Intronic
961545508 3:127630002-127630024 TGTGGGTGCGTGGCGGGCTGGGG + Intronic
961787990 3:129359011-129359033 TGTGCCTGCGAGGGTGGGCGAGG + Intergenic
961792336 3:129385171-129385193 AGTGGGTGACTGGCTGGGGGTGG - Intergenic
961951868 3:130757954-130757976 TGTGCGTGTGTGTGTGGGTGTGG - Intergenic
962136572 3:132741286-132741308 TGTGGGTGGGGGGCTGGAGGAGG - Intergenic
962229554 3:133650358-133650380 TGTGTGTGGGGGGCGGGGGGAGG + Intronic
962254939 3:133864149-133864171 TTTGTGTGCGTGTGTGGGGGGGG + Intronic
962254941 3:133864153-133864175 TGTGCGTGTGTGGGGGGGGGCGG + Intronic
962666052 3:137654508-137654530 TGTTCGAGCTTGGTTGGGGGAGG + Intergenic
964557354 3:157954164-157954186 TGTGTGTGTGTGGAGGGGGGGGG - Intergenic
964670144 3:159216079-159216101 TGTGTGTGTGGGGCGGGGGGTGG + Intronic
964707683 3:159637361-159637383 TGTGTGTGTGTGGCTGGGGCCGG - Intronic
964891443 3:161540822-161540844 TGTATGTGTGTGTCTGGGGGTGG + Intergenic
965285459 3:166813760-166813782 TGTGTGTGTGGGGCGGGGGGGGG - Intergenic
965599066 3:170437505-170437527 TGTGGCTCCATGGCTGGGGGAGG + Intronic
965694655 3:171394906-171394928 TGTGTGTGTGTTGCAGGGGGAGG + Intronic
965739530 3:171859149-171859171 AGTGGGTGGGAGGCTGGGGGAGG + Exonic
965885267 3:173437769-173437791 TGTGTGTTGGTGGGTGGGGGTGG - Intronic
966181932 3:177196736-177196758 TGTGCGTGTGTGTTTGGGGGGGG - Intronic
966417140 3:179701200-179701222 TGTGTGTGCGGGGGTGGGGTGGG + Intronic
967035571 3:185646271-185646293 GGTGCGTGTGTGGGTGGCGGGGG + Intronic
967105352 3:186251094-186251116 TGTGTGTGCATGGCAGTGGGGGG + Intronic
967148072 3:186622843-186622865 TGTGTGTGTGTGTGTGGGGGGGG + Intergenic
967479502 3:189957468-189957490 TGTGTGTGTGTGTTTGGGGGAGG + Exonic
967693154 3:192500439-192500461 TGTGTGTGTGTGGCGGGTGGGGG - Intronic
967748721 3:193088929-193088951 TGTGCATGTGTGTGTGGGGGGGG - Intergenic
967824834 3:193869760-193869782 TGTGTCTGCAGGGCTGGGGGCGG - Intergenic
968103928 3:195988179-195988201 TGTGTGTGTGTGGTGGGGGGTGG - Intergenic
968302230 3:197625769-197625791 TGTGTGTGTGTGGTGGGGGGTGG - Intergenic
968308399 3:197664913-197664935 CGTGCGTCCGTGCCTGGGTGTGG + Intergenic
968795264 4:2699440-2699462 TGTGTGTGTGTGTGTGGGGGGGG - Intronic
968823769 4:2877693-2877715 TGTGGGTGCTTGGCTGGGCATGG + Intronic
968890982 4:3368360-3368382 TGTGTGTGCGTGCCTGTGTGTGG + Intronic
969193743 4:5544414-5544436 TGTGCGTGCATGTGTGTGGGGGG - Intronic
969248852 4:5954231-5954253 TGTGTGTGTCAGGCTGGGGGTGG + Intronic
969421734 4:7101687-7101709 TGTGGGTGGGTGGGTGGGTGGGG + Intergenic
969421738 4:7101691-7101713 GGTGGGTGGGTGGGTGGGGGGGG + Intergenic
969426694 4:7128573-7128595 TGTGTGTGTGTGTCAGGGGGTGG + Intergenic
969767174 4:9238675-9238697 TGTGTGTGTGTGTGTGGGGGGGG - Intronic
969894492 4:10290820-10290842 TGTGTGTGTGTGTGTGGGGGGGG + Intergenic
970197224 4:13563289-13563311 TGTGTGTGTGTGTTTGGGGGAGG + Intergenic
970523525 4:16909094-16909116 TGTGCGTGTGTGTGTGTGGGGGG - Intergenic
970754894 4:19413882-19413904 TGTGTGTGTGTGGCGGGGGGGGG - Intergenic
971344980 4:25803425-25803447 TGTGTATGCGTGGTTTGGGGAGG - Intronic
971504886 4:27355706-27355728 TGTGTGTGTGTTGCGGGGGGAGG + Intergenic
971598152 4:28558244-28558266 TGTGTGTGTGTGGGGGGGGGGGG - Intergenic
971598156 4:28558248-28558270 TGTGTGTGTGTGTGTGGGGGGGG - Intergenic
971599550 4:28575015-28575037 TGTGTGTGTGTGTGTGGGGGGGG - Intergenic
971864208 4:32147711-32147733 TGTGTGTGTGTTGGTGGGGGGGG + Intergenic
971937565 4:33172064-33172086 GGTGGGTGAGTGGGTGGGGGAGG + Intergenic
972380587 4:38516025-38516047 TGTGTGTGTGTGGCGGGCGGGGG - Intergenic
972899263 4:43662454-43662476 TGTGTGTGTGTGGGCGGGGGGGG - Intergenic
973347078 4:49068258-49068280 GGTGGCTGCGAGGCTGGGGGAGG + Intergenic
973532871 4:51850751-51850773 TGTGCGGGCGTGGGGTGGGGTGG + Intronic
973589540 4:52426904-52426926 TGTGTGTGTGTTGCAGGGGGGGG - Intergenic
973708785 4:53605417-53605439 TGTGTATGCGTGTATGGGGGTGG + Intronic
973748108 4:53984471-53984493 TGTGGGTGGGTGGCTATGGGAGG - Intronic
973884098 4:55303125-55303147 GGGGCGTGAGGGGCTGGGGGAGG + Intergenic
974540865 4:63233000-63233022 TGTGCGTGTGTGTGTGGTGGGGG - Intergenic
974566411 4:63582251-63582273 TGTGCGTGTGTGTGTTGGGGGGG + Intergenic
974953292 4:68607163-68607185 TGGGGGTGGGTGGCTGGAGGAGG - Intronic
975078968 4:70251909-70251931 TGTGGGTGGGTGGGTGGGTGTGG - Intergenic
975087176 4:70355914-70355936 AGGGGGTGGGTGGCTGGGGGAGG + Intergenic
975241974 4:72070546-72070568 TGTGTGTGTGTGTGTGGGGGGGG + Intronic
975241978 4:72070550-72070572 TGTGTGTGTGTGGGGGGGGGGGG + Intronic
975799500 4:78045118-78045140 TGTGTGTGTGTGTGTGGGGGAGG + Intergenic
975985921 4:80201873-80201895 TGTGCGTGCGTGCGTGTGTGTGG + Intronic
976894100 4:90086605-90086627 TGTGTGTGTGTGGGGGGGGGGGG + Intergenic
977116864 4:93039317-93039339 TGGGGGTGGGTGGCTAGGGGAGG + Intronic
977150257 4:93502710-93502732 TGTGCGTGTGTGTGTGGGGGGGG - Intronic
978980395 4:114937878-114937900 TGTGTGTGTGTGGCGGGGGGCGG + Intronic
980304135 4:131034679-131034701 TGTGTGTGTGTGGCCGGGGGTGG + Intergenic
982062779 4:151621536-151621558 TGTGTGTGTGTGGCAGGGGGTGG + Intronic
982229594 4:153196261-153196283 TGTGTGTGTGTGGGGGGGGGTGG - Intronic
982229596 4:153196265-153196287 TGTGTGTGTGTGTGTGGGGGGGG - Intronic
982236977 4:153260694-153260716 TGTGTGTGTGTGTGTGGGGGGGG - Intronic
982353485 4:154442531-154442553 TGTGTGTGTGTGGGGGGGGGGGG - Intronic
982353489 4:154442535-154442557 TGTGTGTGTGTGTGTGGGGGGGG - Intronic
982705117 4:158700546-158700568 TGTGTGTGTGTGGTGGGGGGAGG - Intronic
982798235 4:159670874-159670896 TGTGTGTGGGTGGGTGGGTGTGG + Intergenic
982844047 4:160226858-160226880 TGTGCGTGTGTGTGTGTGGGGGG + Intergenic
982960422 4:161828239-161828261 TGAGGGTGTGTGTCTGGGGGTGG + Intronic
983753891 4:171310129-171310151 AGGGGGTGGGTGGCTGGGGGAGG - Intergenic
984399378 4:179242231-179242253 TGTGTGTGTGTGTGTGGGGGGGG + Intergenic
984784407 4:183554325-183554347 TGAGGGTGTGTGGATGGGGGAGG + Intergenic
985058556 4:186056795-186056817 TGGGGGTGGATGGCTGGGGGTGG - Intergenic
985058573 4:186056837-186056859 TGGGGGTGGATGGCTGGGGGTGG - Intergenic
985058590 4:186056879-186056901 TGGGGGTGGATGGCTGGGGGTGG - Intergenic
985058655 4:186057040-186057062 TGGGGGTGGATGGCTGGGGGTGG - Intergenic
985058713 4:186057187-186057209 TGGGGGTGGATGGCTGGGGGTGG - Intergenic
985058730 4:186057229-186057251 TGGGGGTGGATGGCTGGGGGTGG - Intergenic
985058826 4:186057467-186057489 TGGGGGTGGATGGCTGGGGGTGG - Intergenic
985058843 4:186057509-186057531 TGGGGGTGGATGGCTGGGGGTGG - Intergenic
985058918 4:186057698-186057720 TGGGGGTGGATGGCTGGGGGTGG - Intergenic
985058935 4:186057740-186057762 TGGGGGTGGATGGCTGGGGGTGG - Intergenic
985095171 4:186406206-186406228 TGTGCGTGGGTGTGTGTGGGGGG - Intergenic
985144227 4:186877683-186877705 TGTGTGTGTGTGGGTGAGGGGGG + Intergenic
985161260 4:187047252-187047274 TGTGTGTGCGGGGGTGGGTGGGG + Intergenic
985260397 4:188109642-188109664 TGTGAGGGCGGGGCTGAGGGAGG - Intergenic
985427318 4:189843557-189843579 GGTGGGTGTGTGGCTGGAGGTGG - Intergenic
985498092 5:221889-221911 TGTGTGTGTGTGGTGGGGGGTGG + Intronic
985515934 5:344507-344529 TGTGTGTGTGAGGCTGTGGGGGG + Intronic
985515951 5:344594-344616 TGTGTGTGTGAGGCTGTGGGGGG + Intronic
985515968 5:344681-344703 TGTGTGTGTGAGGCTGTGGGGGG + Intronic
985519426 5:366065-366087 TGTGTGTGTGGGGCAGGGGGTGG - Intronic
985611381 5:891539-891561 TGCGCCTGCGTGGCTGGAGGAGG - Intronic
985805696 5:2041264-2041286 CGTCCGTGGGTGGCTGGTGGAGG + Intergenic
985868116 5:2532250-2532272 TGTGCGTTTGTGTGTGGGGGGGG - Intergenic
985961346 5:3305600-3305622 TGTGGGTGAGGGGCTGGGGGTGG + Intergenic
985986543 5:3521209-3521231 TGTGTGTGTGTGGGGGGGGGGGG - Intergenic
986297337 5:6449869-6449891 TGTGTGTGTGTGTGTGGGGGGGG - Intronic
987013965 5:13798053-13798075 TGGGGGTGGGGGGCTGGGGGAGG + Intronic
987095556 5:14546265-14546287 TGTGTGTGTGTGGTGGGGGGTGG + Intergenic
987443721 5:17989743-17989765 TGTGTGTGTGTGGGTGGGTGTGG + Intergenic
987921125 5:24283295-24283317 TGTGTGTGGGTGGGTGGGTGGGG - Intergenic
988349447 5:30083452-30083474 TGTGTGTGTGTGGGTGTGGGTGG + Intergenic
988443482 5:31258486-31258508 TGTGGGTGAGGGGCTAGGGGAGG + Intronic
989138775 5:38181670-38181692 TGGGGGTGGGGGGCTGGGGGAGG + Intergenic
989566170 5:42903671-42903693 TGTGTGTGTGTGTCTGTGGGTGG - Intergenic
990176028 5:53109675-53109697 TGTGCGTGCGGGCCTGGGTGCGG - Exonic
990235573 5:53763740-53763762 TGGGGGTGCGGGGCTGGGGGAGG + Intergenic
990509960 5:56481130-56481152 CGGGCGCGCGGGGCTGGGGGCGG - Intronic
990552012 5:56891149-56891171 TGTGTGTGTGTGGGGGGGGGGGG - Intronic
990552016 5:56891153-56891175 TGTGTGTGTGTGTGTGGGGGGGG - Intronic
990618472 5:57532710-57532732 TGTGTGTGTGTGGGTGGGTGGGG + Intergenic
990795471 5:59535062-59535084 TGTGTGTGTGTGTGTGGGGGGGG + Intronic
991038631 5:62153566-62153588 TGTGTGTGTGTGGGGGGGGGGGG - Intergenic
991038635 5:62153570-62153592 TGTGTGTGTGTGTGTGGGGGGGG - Intergenic
991168568 5:63593391-63593413 TGGGCGTGGCTGGCTGGGCGTGG - Intergenic
991168573 5:63593405-63593427 AGTGCCTGCTTGGCTGGGCGTGG - Intergenic
991295677 5:65077795-65077817 TGTGCGTGTGTGTGTGGGGGGGG - Intergenic
991449825 5:66740095-66740117 TGTGGGTGGGTGGCTGCTGGAGG + Intronic
991769186 5:70025229-70025251 TGCGCGTGCGCGGCCGGGGCTGG - Intronic
991848481 5:70900647-70900669 TGCGCGTGCGCGGCCGGGGCTGG - Intronic
991920502 5:71651768-71651790 TGTGGGTGTGTGGGTGGGGGAGG + Intronic
992038274 5:72803333-72803355 TGGGGGTGGGGGGCTGGGGGAGG - Intergenic
992395892 5:76369457-76369479 TGTGGGGGAGTGGCTGGGCGCGG + Intergenic
992862583 5:80927360-80927382 TGTGTGTGGGTGGGTGGGGTGGG - Intergenic
992862585 5:80927364-80927386 TGTGTGTGTGTGGGTGGGTGGGG - Intergenic
993434174 5:87871157-87871179 TGTGTGTGTGGGGGTGGGGGGGG - Intergenic
993513819 5:88804522-88804544 TATGTGTGTGTGGCAGGGGGAGG + Intronic
993846243 5:92947394-92947416 TGTGTGTGTGGGGCGGGGGGGGG - Intergenic
994382176 5:99084575-99084597 TGTGTGTGTGTGGGGGGGGGGGG + Intergenic
994705782 5:103204997-103205019 AGTGGGTGGGGGGCTGGGGGAGG - Intronic
995039360 5:107570642-107570664 TGTGTGTGTGGGGGTGGGGGCGG + Intronic
995311476 5:110717181-110717203 TGTGTGTATGTGGCGGGGGGTGG - Intronic
995841325 5:116446271-116446293 TGTGTGTGTGTGTGTGGGGGTGG + Exonic
996004955 5:118408307-118408329 TGTGTGTGTGTGTATGGGGGAGG + Intergenic
996210073 5:120798073-120798095 TGTGTGTGTGTGGTGGGGGGTGG + Intergenic
996300271 5:121973601-121973623 TGTGCATGTGTGTGTGGGGGGGG + Intronic
996540345 5:124625011-124625033 TGTGTGTGCTTGGGTGGGGAAGG - Intergenic
996542495 5:124645493-124645515 TGTGTGTGTGTGGGTGGCGGTGG + Intronic
996772122 5:127097003-127097025 TGTGTGTGTGTGGGGGGGGGGGG + Intergenic
996909865 5:128643449-128643471 TGTGTGCGTGGGGCTGGGGGAGG + Intronic
997024023 5:130036780-130036802 TCTGTGTGTGTGGCTGTGGGTGG + Intronic
997096447 5:130918630-130918652 GGTGGGTGAGGGGCTGGGGGAGG + Intergenic
997365404 5:133322259-133322281 TGTGGGTGTGTGGGTGTGGGTGG - Intronic
997614973 5:135240097-135240119 TGTGTGGGCGGGGCTGGAGGTGG - Intronic
997692609 5:135836971-135836993 TGTGTGTGTGTGGGGGGGGGGGG - Intronic
997869907 5:137498256-137498278 TGTGTGTGTGTGGTTGGGAGGGG - Intronic
997871156 5:137506123-137506145 TGTGTGTGTGTTGGTGGGGGTGG - Intronic
998394204 5:141807785-141807807 TGTGTGTGTGTGTGTGGGGGGGG - Intergenic
999393526 5:151211994-151212016 AGTGTGTGCGTGGGTGGTGGTGG + Intronic
999570408 5:152913820-152913842 TGTGGGTGGGGGGATGGGGGAGG - Intergenic
999879791 5:155849412-155849434 TGTGTGTGTGTGGAGGGGGGTGG - Intergenic
1000214847 5:159145536-159145558 AGGGGGTGGGTGGCTGGGGGAGG + Intergenic
1000265902 5:159636279-159636301 TGTGTGTGTGTTGCAGGGGGTGG - Intergenic
1000351075 5:160353482-160353504 TGTGTGTGAGTGGGTGGTGGGGG - Intronic
1000665424 5:163989216-163989238 TGTGCGCGCGCGTGTGGGGGGGG + Intergenic
1001051191 5:168415788-168415810 TGTGTGTGTGTGGGGGGGGGGGG + Intronic
1001230002 5:169978378-169978400 TGTGTGTGTGTGTGTGGGGGGGG + Intronic
1001230006 5:169978382-169978404 TGTGTGTGTGTGGGGGGGGGGGG + Intronic
1001483731 5:172105380-172105402 TATGTGTGCGTGGCAGGGGGTGG - Intronic
1001640491 5:173240441-173240463 TGTGTGTGTGTGGCTGTGAGGGG + Intergenic
1001745862 5:174091674-174091696 TGTGTGTGTGTGTCTGGGGCAGG + Intronic
1001759651 5:174196802-174196824 TGTGCGTTTGTGACTGCGGGAGG + Intronic
1001824400 5:174733745-174733767 GGTGAGAGGGTGGCTGGGGGTGG - Intergenic
1001958507 5:175865048-175865070 TGTGAGTATGTGGTTGGGGGAGG - Intronic
1002051938 5:176576207-176576229 TGGGCGGGGGTGGCTGGGGGAGG + Intronic
1002058006 5:176609830-176609852 TGTGTGCGCGCGGCTGGGGGCGG - Intronic
1002090209 5:176800521-176800543 TGTGTGTGCATGTCTGGGTGTGG + Intergenic
1002090228 5:176800664-176800686 TGTGAGTGCATGTCTGGGTGTGG + Intergenic
1002662625 5:180802363-180802385 CGTGCGTGCGGGGCAGGGAGGGG - Intronic
1003387215 6:5679846-5679868 TGTGCGTTGGGGGGTGGGGGTGG - Intronic
1003577591 6:7312616-7312638 TGAGCGCGAGGGGCTGGGGGTGG + Intronic
1003612105 6:7622941-7622963 TGTGTGTGAGTGGGTTGGGGTGG + Intergenic
1004412302 6:15392071-15392093 TGTGTGTGCGTGTCTGGAGGTGG + Intronic
1004505634 6:16244588-16244610 TGTGTGTTTGTGGGTGGGGGAGG + Intronic
1004525547 6:16404125-16404147 TGTGCATGCGGGGCAGGAGGTGG + Intronic
1004639012 6:17496009-17496031 TGTGCATGCGTGTGTGGGTGGGG + Intronic
1004639016 6:17496013-17496035 CATGCGTGTGTGGGTGGGGGGGG + Intronic
1004681385 6:17898730-17898752 AGTGCGTGTGTGGCTGATGGTGG - Intronic
1004919902 6:20366711-20366733 GGTGCCTGCGGGGATGGGGGTGG + Intergenic
1005154274 6:22785763-22785785 TGTGTGTGTGTGGTGGGGGGTGG - Intergenic
1005463297 6:26089098-26089120 TGTGTGTGTGTGGGGGGGGGGGG + Intronic
1005511618 6:26516936-26516958 TGTGTGTGTGTGGGGGGGGGGGG - Intergenic
1005511622 6:26516940-26516962 TGTGTGTGTGTGTGTGGGGGGGG - Intergenic
1006350971 6:33521015-33521037 TGTGTGTGTGTGGGCGGGGGGGG - Intergenic
1006373201 6:33657846-33657868 TGTGCGTGCATGTGTGGGGCTGG + Intronic
1006447439 6:34087702-34087724 TGTGTGTGTGTGTGTGGGGGGGG - Intronic
1006474354 6:34245122-34245144 TGTGTATGCGTGGGTGGGCGGGG - Exonic
1006517946 6:34555120-34555142 TGTGCGTGCGTGTGTGTGCGCGG - Intronic
1006565636 6:34954350-34954372 TGTGCGTGCGTGTGTGTGTGTGG + Intronic
1006575061 6:35039077-35039099 TGTGTGTGTGTGTGTGGGGGGGG + Intronic
1006804173 6:36777756-36777778 TGTGTGTGTGTGGTGGGGGGGGG - Intronic
1006814337 6:36840127-36840149 TGTGCGCGCGTGGCGGGCCGGGG + Intergenic
1007067629 6:39007937-39007959 TGTGTGTGTGTGGGTGGGTGGGG - Intronic
1007098812 6:39230608-39230630 TGTGTGTGTGTGGCGGGGAGAGG - Intergenic
1007138216 6:39543373-39543395 TGTGTGTGTGTGGGTGGGGGGGG + Intronic
1007210173 6:40187385-40187407 TGTGTGTGTGTGGCGGGGTGAGG + Intergenic
1007394544 6:41570070-41570092 TGTGTGTGTGTGTCAGGGGGTGG - Intronic
1007462902 6:42030908-42030930 TGAGTGTGCGTGGATGGGGGTGG + Intronic
1007784390 6:44271354-44271376 TGTGTGTGTGTGTGTGGGGGGGG + Intronic
1007834565 6:44664663-44664685 TGTGTGTGTGGGGCGGGGGGTGG - Intergenic
1008180355 6:48320535-48320557 TGTGTGTGTTTGGGTGGGGGGGG + Intergenic
1008382102 6:50847692-50847714 TGTGGGTGCTTCGATGGGGGAGG - Intergenic
1008396725 6:51017299-51017321 TGTGTGTGTGTGGGGGGGGGGGG + Intergenic
1008544118 6:52570793-52570815 TGTGCGTGTGGGGGGGGGGGTGG - Intronic
1008544120 6:52570797-52570819 TGTGTGTGCGTGTGGGGGGGGGG - Intronic
1008815733 6:55563264-55563286 TGTGCTTGGGTGGCAAGGGGTGG + Intronic
1009469170 6:64010379-64010401 TGTGTGTGTTTGGTTGGGGGGGG + Intronic
1010478594 6:76320877-76320899 TGTGTGTGTGTTGCTGGGAGGGG + Intergenic
1010652115 6:78467623-78467645 GGTGGGAGCGAGGCTGGGGGAGG + Intergenic
1010899923 6:81414413-81414435 TGTGTGTGTGTGTCTGGGTGTGG + Intergenic
1011099929 6:83709201-83709223 TGTGTGTGAGTAGCTGGGAGGGG - Exonic
1011891084 6:92160511-92160533 TGTGTGTGTGTGGGGGGGGGGGG + Intergenic
1012900323 6:104997544-104997566 CGTGTGTGTGTGGCGGGGGGGGG - Intronic
1013244662 6:108275079-108275101 GGTGTGTGTGTGGCAGGGGGTGG + Intergenic
1013263670 6:108472383-108472405 TGTGTGTGAGGGGTTGGGGGCGG - Intronic
1013760671 6:113513652-113513674 TGTGCGTGTGTGTCGGGGGGTGG - Intergenic
1014192994 6:118519463-118519485 TGTGTGTGTGTGGCGGGGGGGGG + Intronic
1014193012 6:118519571-118519593 TGTGTGTGTGTGGCGGGGGGGGG + Intronic
1014370720 6:120604028-120604050 TGTGTGTGGGGGGGTGGGGGTGG + Intergenic
1014505563 6:122249780-122249802 TGTGTGTGTGCGGCGGGGGGCGG + Intergenic
1015496660 6:133889913-133889935 AGTGCGCGCGGGGCTGGGAGTGG + Intronic
1015988189 6:138907329-138907351 TGTGTGTGTGTGGCGGGGAGGGG + Intronic
1016068353 6:139707590-139707612 TGTGTGTGGGTTGCGGGGGGAGG + Intergenic
1016329702 6:142944413-142944435 TGTGTGTGGGTGTGTGGGGGAGG - Intronic
1016665609 6:146636607-146636629 TGTGAGTGTGTGGGTGTGGGTGG + Intronic
1016814092 6:148287678-148287700 AGTGCGTGCGTGTGTGTGGGGGG + Intronic
1017006845 6:150033569-150033591 TGTGTGTGTGTGTGTGGGGGGGG + Intergenic
1017020573 6:150136818-150136840 TGTGTGTGCGTGTGTGTGGGAGG - Intergenic
1017048923 6:150372434-150372456 TGTGTGTGTGTGGGTGGGGTGGG + Intronic
1017412062 6:154178138-154178160 GGTGGGTGGGGGGCTGGGGGAGG + Intronic
1017876894 6:158532224-158532246 TATGTGTGAGTGGGTGGGGGCGG - Intergenic
1018297091 6:162360082-162360104 TGTGTGTGTGTGGGTGGGTGTGG + Intronic
1018378836 6:163239672-163239694 TGTGCGTGTGTGTGTAGGGGTGG - Intronic
1018508362 6:164495457-164495479 TATCCCTGCGGGGCTGGGGGAGG + Intergenic
1018588035 6:165384657-165384679 TGTGTGTGTGTGTATGGGGGGGG + Intronic
1018617886 6:165705077-165705099 TGTGCGTGCCATGCTGGGGGCGG - Intronic
1019036755 6:169067316-169067338 TGTGTGTGTGTGGGGGGGGGGGG - Intergenic
1019036759 6:169067320-169067342 TGTGTGTGTGTGTGTGGGGGGGG - Intergenic
1019328344 7:450721-450743 TCTGCGGGAGGGGCTGGGGGTGG - Intergenic
1019381695 7:727410-727432 GGTGCGGGCGTGGAGGGGGGCGG - Intronic
1020169414 7:5833418-5833440 TGTGCCCGCGAGGCGGGGGGTGG + Intergenic
1020210503 7:6154670-6154692 AGGGCGAGCGTGGCTGGGGCCGG + Exonic
1020278009 7:6636622-6636644 TGTGGGTGGGGGTCTGGGGGTGG + Intergenic
1020394498 7:7699035-7699057 TGTGTGTGTGTGTGTGGGGGGGG + Intronic
1020579901 7:9983940-9983962 TGTGTGTGTGTGGGGGGGGGGGG + Intergenic
1020873578 7:13665851-13665873 TGTGTGTGTGTGGGGGGGGGGGG - Intergenic
1021652083 7:22842235-22842257 TGTATGTGTGTGGCGGGGGGAGG - Intergenic
1021917721 7:25452348-25452370 TGTGTGTGTGTGGTTGGGGGTGG - Intergenic
1022096801 7:27146262-27146284 TGTGTGTGTGTGTCTGGGGTGGG + Intronic
1022353569 7:29588894-29588916 GGTGCATGGGGGGCTGGGGGAGG - Intergenic
1022388975 7:29927352-29927374 TGTGTGTGGGTGGGTGGGTGGGG - Intronic
1022684772 7:32586462-32586484 TGTGTGTGTGTGGGGGGGGGGGG - Exonic
1022747530 7:33188101-33188123 TGTGTGTGTGTGGCGGGTGGGGG + Intronic
1022993391 7:35730081-35730103 TGTGTGTGTGTGGGTGGGTGGGG - Intergenic
1023259267 7:38341807-38341829 TGTGTGTGTGTGGCGGGGGGCGG + Intergenic
1023319492 7:38977838-38977860 TGTGTGTGCGTGTCTGCCGGAGG + Intergenic
1023780182 7:43647875-43647897 TGTGCTGGGCTGGCTGGGGGTGG - Intronic
1023826761 7:44014954-44014976 TGTGTGTGTGTGGCGGGGGTAGG - Intergenic
1024169633 7:46770275-46770297 TGTGTGTGTGGGGTTGGGGGGGG + Intergenic
1024343887 7:48293194-48293216 AGTGTGTGTGTGGCGGGGGGGGG - Intronic
1024427491 7:49244176-49244198 TGTGTGTTGGTGGCTGGGGAAGG - Intergenic
1024934119 7:54695625-54695647 TGTGTGTGTGTGGGTGGGTGTGG - Intergenic
1024967410 7:55036261-55036283 TGTGTGTGTGTGGGGGGGGGGGG + Intronic
1024972027 7:55079275-55079297 TGTGCATGCCTGGCTCTGGGCGG - Intronic
1025211191 7:57020376-57020398 TGTGTGGGCGGGGCTGGGGCGGG - Intergenic
1025629732 7:63259950-63259972 TGTGGGTGTGTGTGTGGGGGCGG - Intergenic
1025660764 7:63556471-63556493 TGTGTGGGCGGGGCTGGGGCGGG + Intergenic
1025886931 7:65604560-65604582 TGTGTGTGTGTGGTTGGAGGAGG + Intergenic
1026539817 7:71269804-71269826 TGTGATAGCATGGCTGGGGGAGG + Intronic
1026843351 7:73683233-73683255 TGGGCCTGCGTGGCTGTGGAGGG + Exonic
1026869105 7:73840122-73840144 TGTGTGTGTGTGGGGGGGGGTGG + Intronic
1027137860 7:75637982-75638004 TGTGTGTGTGTGGGGGGGGGGGG - Intronic
1027219131 7:76202681-76202703 TGGGCGTCCGTGGTTGGGGTGGG - Intronic
1027729596 7:81853915-81853937 TGTGTGTGGGTGGGTGGGTGGGG - Intergenic
1027828086 7:83142036-83142058 TGTGTGTGTGTGTCGGGGGGAGG - Intronic
1027884103 7:83881097-83881119 TGTGCGTGCGTGTGTGTGTGTGG - Intergenic
1028050068 7:86174346-86174368 GGTGGCAGCGTGGCTGGGGGAGG + Intergenic
1028091691 7:86710553-86710575 TGTGTGTGTGTGGTGGGGGGTGG + Intronic
1028094457 7:86743334-86743356 TTTCTGTGTGTGGCTGGGGGAGG - Intronic
1028236635 7:88370939-88370961 GGTGGGTGAGTGGCTGAGGGAGG - Intergenic
1028412342 7:90543922-90543944 TGTGTGCGTGTGGCTGGGAGGGG - Intronic
1028572904 7:92311718-92311740 TGTGTGTGTGTGTGTGGGGGGGG - Intronic
1029465145 7:100720685-100720707 TGTGCGTGCGCGGGTGGGGGTGG - Intergenic
1030911142 7:115250971-115250993 TGTGTGTGTGTGGCGGGGAGGGG + Intergenic
1031319733 7:120309541-120309563 TGTGTGTGTGTGTCTGTGGGGGG - Intronic
1031440147 7:121784652-121784674 TGTGTGTGTCTGTCTGGGGGAGG + Intergenic
1031855485 7:126917363-126917385 TGTGTGTGTGTGGTTGGAGGAGG - Intronic
1031954669 7:127930137-127930159 TGTGCAAGGGTGGCTGGGCGGGG - Intronic
1032016218 7:128381823-128381845 TGTGAGGGCCTGGCGGGGGGTGG - Intergenic
1032018326 7:128393389-128393411 TGTGCCTGCAGGGCTGGGGCTGG - Intronic
1032057759 7:128697392-128697414 TCTGAGGGCGTGGCTGGGCGGGG + Intergenic
1032086756 7:128888011-128888033 TGTGTGTGTGTGGCTGTGTGTGG - Intronic
1032091214 7:128912555-128912577 TGTGTGTGTGTGTCTGGGTGTGG + Intergenic
1032189513 7:129756097-129756119 TGTGTGTGCGTGCATGGTGGGGG + Exonic
1032525536 7:132576544-132576566 TTTGCGTTCGGGGCTGGGGCTGG - Exonic
1032967315 7:137114114-137114136 TGTGTGTGTGTGTGTGGGGGGGG + Intergenic
1033827778 7:145213302-145213324 GGTGGGTGGGGGGCTGGGGGAGG - Intergenic
1034104531 7:148478955-148478977 TGTGTGTGTGTGTCTGTGGGGGG + Intergenic
1034416378 7:150966385-150966407 TGTGTGTGTGTGTGTGGGGGGGG - Intronic
1034423277 7:151000127-151000149 TGTGAGTGGGTGGGTGAGGGGGG + Intronic
1034480101 7:151313277-151313299 TGTGTGTGAGTGGGTGGGAGAGG + Intergenic
1034889418 7:154827190-154827212 TGTGTGTGTGTGTCTGGGAGGGG - Intronic
1035002816 7:155628341-155628363 AGTGGGTGGGGGGCTGGGGGAGG + Intronic
1035021611 7:155804034-155804056 GGTGTGTGCGGAGCTGGGGGTGG - Intronic
1035054494 7:156025247-156025269 TGTGTGTGGGTGGGTGGGTGTGG + Intergenic
1035054499 7:156025273-156025295 TGTGTGTGTGTGGATGGGTGTGG + Intergenic
1035169688 7:157010543-157010565 TGTGCGAGCGCGGCCCGGGGCGG - Exonic
1035443289 7:158921700-158921722 GGTGTGTGTGTGGCTGGGGTTGG + Intronic
1035487701 7:159240189-159240211 TGTGTGTGTGTGGCGGGGGGAGG + Intergenic
1035704756 8:1667060-1667082 TGTGTGTGTGTGGCAGGGGTGGG + Intronic
1036273170 8:7325884-7325906 TGTGTGTGTGTGGCGGGGGGTGG - Intergenic
1036348180 8:7984466-7984488 TGTGTGTGTGTGGCGGGGGGGGG + Intergenic
1036579650 8:10062037-10062059 AGTGGGAGCCTGGCTGGGGGAGG + Intronic
1036692236 8:10951288-10951310 TGTGTGTGTGTGGGGGGGGGGGG + Intronic
1037092909 8:14945151-14945173 TGTGTGTGGGTGGGTGGGGGGGG + Intronic
1037110548 8:15159749-15159771 TGTGTGTGTGTGGCGGGGGTGGG - Intronic
1037162614 8:15791271-15791293 TGTTTGTGCGTGGGTTGGGGGGG - Intergenic
1037384975 8:18329298-18329320 TGTGAGTGTGTGGCGGGGGGCGG - Intergenic
1037509148 8:19563913-19563935 TGAGTGTGCGTGGCTGAGGGAGG - Intronic
1037548529 8:19947658-19947680 TGTGTGTGTGGGGCGGGGGGGGG - Intronic
1037670727 8:21013139-21013161 TGTGTGTGTGTGGGGGGGGGGGG - Intergenic
1037670731 8:21013143-21013165 TGTGTGTGTGTGTGTGGGGGGGG - Intergenic
1038183043 8:25246745-25246767 TGTGTGTGTGTGGCGGGGGCGGG + Intronic
1038750897 8:30294885-30294907 GGGGGGTGGGTGGCTGGGGGAGG - Intergenic
1038884523 8:31648571-31648593 TGTTTGTCAGTGGCTGGGGGAGG - Intronic
1039269226 8:35862643-35862665 TGTGTGTGTGTGCTTGGGGGTGG + Intergenic
1039737112 8:40344823-40344845 TGTGCATGTGGGGCTGGTGGGGG + Intergenic
1039838527 8:41277205-41277227 TGAGGGTGGGGGGCTGGGGGTGG - Intronic
1039965099 8:42278274-42278296 AGTGCCTGGGTGGCTGAGGGTGG + Intronic
1041608268 8:59811538-59811560 TGTGTGTGTGTGTTTGGGGGTGG + Intergenic
1042164542 8:65933097-65933119 TGTGTGTGCATGCATGGGGGAGG + Intergenic
1042484006 8:69331877-69331899 TGTGCGGACGGGGCTGGTGGAGG - Intergenic
1042960637 8:74300395-74300417 TGTGTGTGCGTTGTGGGGGGCGG + Intronic
1043725078 8:83601308-83601330 TGTGTGTGTGTGGTCGGGGGAGG + Intergenic
1043770480 8:84192892-84192914 TGTGTGTGTGTGTGTGGGGGGGG + Intronic
1044646493 8:94449190-94449212 TGTGTGTGTGTGGTGGGGGGCGG - Intronic
1045096755 8:98805939-98805961 TGTGCTTGTGTGGATGGGTGGGG - Intronic
1045230782 8:100304490-100304512 TGTGAGTGCGTAAGTGGGGGTGG - Intronic
1045490301 8:102663125-102663147 TGGGCCTGCGTGACTGGGGCTGG - Intergenic
1045594533 8:103636790-103636812 TGTGTGTGTGTGGGGGGGGGGGG - Intronic
1045677427 8:104623293-104623315 TGTGTGTGTGTTGGTGGGGGTGG + Intronic
1045739142 8:105334149-105334171 TGTGTGTGTGTGGTGGGGGGAGG + Intronic
1045776966 8:105815985-105816007 AGTTAGTGGGTGGCTGGGGGTGG - Intergenic
1046312712 8:112459348-112459370 TGTGTGTGTGTGGGGGGGGGGGG + Intronic
1046605689 8:116369242-116369264 TGTGTGTGTGTGTGTGGGGGGGG + Intergenic
1046605693 8:116369246-116369268 TGTGTGTGTGTGGGGGGGGGGGG + Intergenic
1047039178 8:120973915-120973937 TGTGTGTGTGTGTTTGGGGGTGG + Intergenic
1047041429 8:121001042-121001064 TGTGTGTGTGTTGGTGGGGGTGG + Intergenic
1048035060 8:130670003-130670025 TGTGTGTGTGTGGGTGTGGGTGG + Intergenic
1048071877 8:131029845-131029867 TGTGTGTGTGTGGGTGGGGGTGG + Intronic
1048187839 8:132260584-132260606 TGGGAGTGGGTGGCTGGGGTAGG + Intronic
1048522457 8:135169440-135169462 TGTGTGTGTGTGTCTTGGGGAGG + Intergenic
1048633612 8:136271551-136271573 TGTGTGTGTGTGGCGGGGGGGGG - Intergenic
1048843743 8:138587139-138587161 TGTATGTGGGTGGTTGGGGGTGG + Intergenic
1049039608 8:140102463-140102485 TGTGTGTGTGTGGTGGGGGGAGG - Intronic
1049298062 8:141854500-141854522 TGTGTGTGTGTGGGGGGGGGGGG - Intergenic
1049298066 8:141854504-141854526 TGTGTGTGTGTGTGTGGGGGGGG - Intergenic
1049316888 8:141974169-141974191 TGTGCGTGTGTGCCTGCAGGTGG + Intergenic
1049406336 8:142453262-142453284 TGTGTGTGCGTGACGGGGGCGGG + Intronic
1049438971 8:142600611-142600633 TGTCCTGGGGTGGCTGGGGGTGG + Intergenic
1049641241 8:143716927-143716949 TGTGTGTGCGTGGGTGTGTGGGG + Intronic
1049765787 8:144354595-144354617 GGTGCGCGCGAGGCTGGGCGGGG - Exonic
1049886869 9:33451-33473 AGTGGGTGGGGGGCTGGGGGAGG - Intergenic
1050131765 9:2420288-2420310 TGTGTGTGTGTGGCGGGGTGGGG + Intergenic
1050596011 9:7205356-7205378 TGTGTGTGTGTGTGTGGGGGGGG + Intergenic
1050596015 9:7205360-7205382 TGTGTGTGTGTGGGGGGGGGGGG + Intergenic
1050651852 9:7785316-7785338 TGTGTGTGTGGGGCGGGGGGGGG - Intergenic
1050735733 9:8760617-8760639 TGTGTGTGTGTGGCGGTGGGGGG + Intronic
1050800176 9:9601138-9601160 TGTGTGTGTGTGTATGGGGGGGG + Intronic
1050957530 9:11683651-11683673 GGTGTGTGTGTGGCGGGGGGCGG + Intergenic
1051096030 9:13466051-13466073 TGTGTGTGTGTGGGGGGGGGGGG + Intergenic
1051157522 9:14167070-14167092 TGTGTGTGTGTGTCGGGGGGGGG + Intronic
1051174718 9:14350027-14350049 CGTGCGTGCGTGCCTGGTGAAGG - Intronic
1051868626 9:21711008-21711030 TGTGCTTGCGTGTGTGGGGGGGG + Intergenic
1052078248 9:24171937-24171959 TGTGTGTGTGTGGCAGGGGGAGG + Intergenic
1052228273 9:26116313-26116335 TTTGTGGGCGTGGCAGGGGGAGG + Intronic
1052340415 9:27359368-27359390 TGTGTGTGTGTGGGGGGGGGGGG + Intronic
1053202861 9:36164602-36164624 TGTGTGTGTGTGTATGGGGGTGG - Intergenic
1053272407 9:36759387-36759409 TGTGTGTGTGTGTGTGGGGGGGG + Intergenic
1053272411 9:36759391-36759413 TGTGTGTGTGTGGGGGGGGGGGG + Intergenic
1053307438 9:36994489-36994511 TGTGCGTGCGTGTATGTGTGTGG - Intronic
1053462936 9:38284674-38284696 TGGGGGTGCGGGGCTGGGGAGGG - Intergenic
1053504461 9:38629797-38629819 TGTGTGTGTGTGGGTGTGGGTGG - Intergenic
1053537027 9:38936202-38936224 TGTGGGTGCGTGTGTGGGGGGGG + Intergenic
1053886787 9:42649884-42649906 TGAGGGTGTGTGGGTGGGGGTGG - Intergenic
1053918334 9:42962591-42962613 TGTGTGTGTGTGTGTGGGGGGGG - Intergenic
1054225806 9:62457334-62457356 TGAGGGTGTGTGGGTGGGGGTGG - Intergenic
1054246882 9:62675581-62675603 TGTGTGTGTGTGTGTGGGGGGGG + Intergenic
1054246886 9:62675585-62675607 TGTGTGTGTGTGGGGGGGGGGGG + Intergenic
1054629109 9:67427728-67427750 TGTGGGTGCGTGTGTGGGGGGGG - Intergenic
1055371114 9:75600719-75600741 TGTGTGTGGGTGGGTGGGTGTGG + Intergenic
1055532036 9:77194180-77194202 TGTGCGTGGGTGGATGCTGGTGG + Intronic
1055907434 9:81310644-81310666 TGTGAGTGTGTGGGGGGGGGCGG + Intergenic
1056217125 9:84415870-84415892 TGGGGTTGTGTGGCTGGGGGTGG + Intergenic
1056470942 9:86903932-86903954 TGTGTGTGTGTGGCAGGGGGTGG - Intergenic
1057045101 9:91879419-91879441 TGTGGGTGTGTGGGTGTGGGGGG + Intronic
1057212256 9:93206582-93206604 GGTGGCTGCGTGACTGGGGGAGG + Intronic
1057273422 9:93663639-93663661 TGTGAGTGCCTGGATGGGAGGGG + Intronic
1057439307 9:95071280-95071302 TGTGTGTGTGGGGCGGGGGGAGG - Intronic
1057564735 9:96157607-96157629 TGTGTGTGTGTGTGTGGGGGGGG + Intergenic
1057662437 9:97014879-97014901 TGTGTGTGTGTGTTTGGGGGTGG - Intergenic
1057873460 9:98735017-98735039 TGGGCTTTCATGGCTGGGGGAGG + Exonic
1057995732 9:99820548-99820570 TGTGTGTGTGTGGCGGGGGCGGG - Intergenic
1058083201 9:100720994-100721016 TGTGTGTGTGTTGGTGGGGGGGG - Intergenic
1058622612 9:106899229-106899251 TGTGTGTGTGTGGGGGGGGGGGG + Intronic
1059513358 9:114870006-114870028 TGCTCGAGCTTGGCTGGGGGAGG + Intergenic
1059621539 9:116011180-116011202 TGTGTGTGTGGGGGTGGGGGTGG + Intergenic
1059864660 9:118501233-118501255 GGTGCCAGCCTGGCTGGGGGAGG - Intergenic
1060520044 9:124289177-124289199 TGTGTGTGTGTGGCGGGGGGGGG - Intronic
1060584841 9:124779534-124779556 TGTGTGTGTGTGGTGGGGGGGGG + Intronic
1060780337 9:126407619-126407641 TGTGAGGGCGTCGGTGGGGGTGG - Intronic
1060943433 9:127556357-127556379 TGTGTGTGTGTGGTTGGTGGGGG - Intronic
1060975717 9:127763968-127763990 TGGGCGGAGGTGGCTGGGGGAGG - Intronic
1061466135 9:130781368-130781390 AGTGCGTGTGTGCCTGAGGGTGG - Intronic
1061788419 9:133044896-133044918 TGTGTGTGGGTGGCAGGGGGTGG - Intronic
1061936834 9:133862583-133862605 TGTACGTGTGTGTCTGGGGGTGG + Intronic
1062032666 9:134368999-134369021 TGTGTGTGTGTGTGTGGGGGGGG + Intronic
1062106833 9:134759824-134759846 TGTGCGTGAGTGGGGGGGTGTGG - Intronic
1062200163 9:135298601-135298623 TGTGGGTGCGTGACTGGGGGAGG + Intergenic
1062204930 9:135330753-135330775 TATGTGTGTGTGGCTGTGGGAGG - Intergenic
1062205911 9:135337196-135337218 TGTGCGTGTGTGGGCGTGGGTGG + Intergenic
1062288755 9:135785409-135785431 TGTGGGTGGGTGGGTGGGTGGGG - Intronic
1062307039 9:135913506-135913528 TGTGTGTGTGTGTGTGGGGGGGG - Intergenic
1062342398 9:136099621-136099643 TGTGTGTGCGGGGCGGCGGGTGG + Intergenic
1062464638 9:136675642-136675664 TGTGATGGGGTGGCTGGGGGTGG - Intronic
1062517167 9:136942525-136942547 GGTGCGTGCGGGGCTAGGGGCGG - Exonic
1062559142 9:137131701-137131723 TGTGTGTGTGTGGGGGGGGGGGG - Intergenic
1203470589 Un_GL000220v1:113961-113983 TGGGCGGGCGGGGCCGGGGGTGG + Intergenic
1203478410 Un_GL000220v1:157933-157955 TGGGCGGGCGGGGCCGGGGGTGG + Intergenic
1203636744 Un_KI270750v1:119810-119832 TGTGTGTGTCTGGGTGGGGGAGG + Intergenic
1185692330 X:2165709-2165731 CATGCGTGTGTGGCTGGGTGCGG - Intergenic
1185709723 X:2293808-2293830 TGTGTGTGTGTGGTGGGGGGAGG + Intronic
1185771728 X:2770006-2770028 TGTGCGTGTGTGGAGGGGTGGGG + Intronic
1186314332 X:8352487-8352509 TGTGTGTGTGTTGCTCGGGGAGG + Intergenic
1186467289 X:9793622-9793644 TGTGCCTGAGTAGTTGGGGGAGG - Intronic
1186808231 X:13161481-13161503 TGTGTGTGTGTGGCGGGTGGGGG + Intergenic
1186861571 X:13677663-13677685 TGTGCGCGTGTGTGTGGGGGTGG + Intronic
1187484412 X:19688615-19688637 TGTGTGTGGGTGGGTGTGGGAGG - Intronic
1187710146 X:22045036-22045058 TGTGTGTGTGTTGTTGGGGGAGG + Intronic
1188156465 X:26748593-26748615 TGTGTATGCGTGGGTGGGCGGGG - Intergenic
1188170464 X:26918186-26918208 TGTGTGTGTGTGGAGGGGGGTGG + Intergenic
1188370021 X:29358405-29358427 TCTGTGTGTGTGGCGGGGGGTGG - Intronic
1188450784 X:30306899-30306921 TGTGTGTGTGTGGTTGGGGGTGG - Intronic
1188562234 X:31482222-31482244 TGTGTGTGTGTGTGTGGGGGGGG + Intronic
1188666401 X:32827059-32827081 TGTGTGTGTGTGTGTGGGGGGGG - Intronic
1189055262 X:37692964-37692986 TGTGGGTGTGTGTGTGGGGGGGG - Intronic
1189097298 X:38154191-38154213 TGTGTGTGTGTGGTTGGTGGAGG - Intronic
1189269268 X:39739424-39739446 TGTGTGTGTGTGTCGGGGGGTGG - Intergenic
1189289646 X:39876092-39876114 TGGGAGTGGGAGGCTGGGGGTGG - Intergenic
1189463015 X:41257685-41257707 TGTGCATGCATGCATGGGGGTGG - Intergenic
1189522384 X:41783435-41783457 TGTGCCTGGGAGGCTGAGGGAGG + Intronic
1189578358 X:42379857-42379879 TGTGTGTGTGTGGGTTGGGGGGG - Intergenic
1190009807 X:46774747-46774769 TGTGTGTGTGTGTGTGGGGGGGG + Intergenic
1190009811 X:46774751-46774773 TGTGTGTGTGTGGGGGGGGGGGG + Intergenic
1190106920 X:47567442-47567464 CATGTGTGCGTGGATGGGGGTGG + Intronic
1190485467 X:50919291-50919313 GGAGGGTGCGTGGGTGGGGGTGG + Intergenic
1191699391 X:64023287-64023309 TGTGTGTGTGTGTGTGGGGGGGG - Intergenic
1192072757 X:67958496-67958518 TATGTGTGTGTGGGTGGGGGAGG - Intergenic
1192168846 X:68842213-68842235 TGTGCGTGCGTGTGTGGTGGGGG + Intergenic
1192209865 X:69121063-69121085 TGTCCGGGTGTGGCTGGGTGTGG + Intergenic
1192728347 X:73776427-73776449 AGTGGGTGGGAGGCTGGGGGAGG + Intergenic
1192784452 X:74323113-74323135 TGTGCGTGTGTGGCAGGGGAGGG - Intergenic
1192804180 X:74495195-74495217 TGTGTGTGTGTGGCAGGGGAGGG + Intronic
1193145075 X:78067710-78067732 TGTGTGTGTGTTGGTGGGGGGGG + Intronic
1193447665 X:81623998-81624020 TGTGTGTGTGTGGGTGGGAGGGG + Intergenic
1193649872 X:84117945-84117967 TGTGTGTGTGTGGCAGGGGGTGG - Intronic
1193926067 X:87487115-87487137 TGTGCGTGTGTGTGTGGGGGGGG + Intergenic
1194235676 X:91380815-91380837 TGTGTGTGCGTGGGGGGGGGGGG - Intergenic
1194471832 X:94306191-94306213 TGTGGGTGGGTGGGTTGGGGAGG + Intergenic
1195109632 X:101633928-101633950 AGTGGGTGGGTGGCTAGGGGAGG - Intergenic
1195301526 X:103534869-103534891 TGTGTGTGTGTGGGGGGGGGTGG - Intergenic
1195547112 X:106125146-106125168 CGGGAGTGGGTGGCTGGGGGAGG - Intergenic
1195606081 X:106807204-106807226 TGTGTGTGTGTGTATGGGGGGGG - Intronic
1196387500 X:115174595-115174617 TGTGTGTGTGTGTGTGGGGGGGG - Intronic
1197619605 X:128733155-128733177 GGTGGCTGCGAGGCTGGGGGAGG + Intergenic
1197644793 X:129005727-129005749 TGTGTGTGTGTGGGTGGGGCGGG - Intergenic
1197709444 X:129655079-129655101 AGTGCGTGCCTGGAGGGGGGCGG - Intergenic
1197756724 X:130000917-130000939 TGTGTGTGTGTGTCGGGGGGTGG + Intronic
1197972302 X:132127943-132127965 TGGGAATGCCTGGCTGGGGGTGG - Exonic
1198796945 X:140407138-140407160 GGTGGGTGGGGGGCTGGGGGAGG + Intergenic
1198823351 X:140673066-140673088 GGTGTGTGTGTGGTTGGGGGTGG + Intergenic
1199053054 X:143260064-143260086 TGTGTGTGTGTGGGGGGGGGGGG - Intergenic
1199053058 X:143260068-143260090 TGTGTGTGTGTGTGTGGGGGGGG - Intergenic
1199160934 X:144610866-144610888 TGTGTGTGTGTGTGTGGGGGTGG + Intergenic
1199387006 X:147234675-147234697 TGTGTGTGTGTGGGGGGGGGGGG - Intergenic
1199450989 X:147978926-147978948 TGTGTGTGTGTGTGTGGGGGGGG + Intergenic
1199469812 X:148181885-148181907 TGTGCGAGCGTGGTGGGGGGAGG - Intergenic
1199965735 X:152819110-152819132 TGTGTGTGTGTGTTTGGGGGTGG - Intergenic
1200092814 X:153643750-153643772 TGTGCGTGTCGGGGTGGGGGAGG + Intronic
1200237836 X:154477703-154477725 TGTGCTTGGGTTGCTGGGGGGGG - Intergenic
1200268084 X:154656961-154656983 TGGGGGTGGGGGGCTGGGGGAGG + Intergenic
1200587674 Y:5028885-5028907 TGTGTGTGTGTGTCTGTGGGGGG + Intronic
1201077589 Y:10199291-10199313 TGTGTGTGCGAGTCGGGGGGCGG + Intergenic
1201538623 Y:15080973-15080995 TGTGTGTGTGTGTGTGGGGGGGG + Intergenic
1201538627 Y:15080977-15080999 TGTGTGTGTGTGGGGGGGGGGGG + Intergenic
1201676166 Y:16586950-16586972 TGTGTGTGTGTGGCGGGGTGGGG - Intergenic
1201757059 Y:17497782-17497804 TGAGGGTGGGGGGCTGGGGGCGG + Intergenic
1201844495 Y:18408202-18408224 TGAGGGTGGGGGGCTGGGGGCGG - Intergenic