ID: 1152466739

View in Genome Browser
Species Human (GRCh38)
Location 17:80470927-80470949
Sequence GGCCAGGTTGTACACCTCCC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 124
Summary {0: 1, 1: 0, 2: 2, 3: 4, 4: 117}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152466732_1152466739 19 Left 1152466732 17:80470885-80470907 CCAGGCGATGACATTGCCGGACA 0: 1
1: 0
2: 0
3: 3
4: 24
Right 1152466739 17:80470927-80470949 GGCCAGGTTGTACACCTCCCCGG 0: 1
1: 0
2: 2
3: 4
4: 117
1152466734_1152466739 3 Left 1152466734 17:80470901-80470923 CCGGACAGAGCCTTGGTGCTGCA 0: 1
1: 0
2: 1
3: 14
4: 160
Right 1152466739 17:80470927-80470949 GGCCAGGTTGTACACCTCCCCGG 0: 1
1: 0
2: 2
3: 4
4: 117
1152466737_1152466739 -7 Left 1152466737 17:80470911-80470933 CCTTGGTGCTGCAGGTGGCCAGG 0: 1
1: 0
2: 9
3: 47
4: 386
Right 1152466739 17:80470927-80470949 GGCCAGGTTGTACACCTCCCCGG 0: 1
1: 0
2: 2
3: 4
4: 117
1152466731_1152466739 20 Left 1152466731 17:80470884-80470906 CCCAGGCGATGACATTGCCGGAC 0: 1
1: 0
2: 0
3: 0
4: 30
Right 1152466739 17:80470927-80470949 GGCCAGGTTGTACACCTCCCCGG 0: 1
1: 0
2: 2
3: 4
4: 117

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152466739 Original CRISPR GGCCAGGTTGTACACCTCCC CGG Exonic
900097177 1:944630-944652 GGCCAGTGTTTCCACCTCCCTGG - Exonic
900493755 1:2966762-2966784 AGCCAGCTTGGAGACCTCCCTGG - Intergenic
900514468 1:3074733-3074755 GGGCAGGTCCTACACCTCCCGGG - Intronic
901199274 1:7457542-7457564 GGCCAGGCTGCACACCTCCCTGG + Intronic
905105736 1:35562564-35562586 GGCCAGGTTGGCCACCTGCTGGG - Exonic
906412752 1:45592322-45592344 GCCCAGGTTGGAGACCACCCTGG - Intronic
911661564 1:100507753-100507775 TCCCAGGTTCTCCACCTCCCAGG + Intronic
912518889 1:110232114-110232136 GCCCAGGTGGTAGACATCCCAGG + Intronic
912717896 1:111994809-111994831 GCCCAGGTTGTCCAGCTTCCAGG + Intergenic
913020246 1:114781951-114781973 GGGCAGGTAGCACACCACCCTGG - Intergenic
920090894 1:203452315-203452337 GGACTGGTAGTACACCTCCTGGG - Intergenic
1064659539 10:17592564-17592586 GGCCAGAGTCTACATCTCCCAGG + Intronic
1067278352 10:44853489-44853511 GGGCAGGCTGTCCAGCTCCCTGG - Intergenic
1067581706 10:47450524-47450546 GGCCAAGGTGTGCACCACCCAGG + Intergenic
1069921792 10:71820044-71820066 GGCAATGGTGTCCACCTCCCCGG + Intronic
1071815760 10:89231389-89231411 CCCCAGGTTGTACAACTCCAGGG - Intronic
1076475975 10:130751672-130751694 GTCCAGGTTCTCCACTTCCCAGG - Intergenic
1076874924 10:133211223-133211245 GCCCAGGCTGGGCACCTCCCTGG + Intronic
1078162974 11:8857793-8857815 GGGCAGGTCCTACACCTCTCTGG + Intronic
1078642358 11:13108561-13108583 AGCCAGGTTGTCCAGCTACCTGG - Intergenic
1084198064 11:67537180-67537202 GGACAGGTAGCACACCACCCTGG + Intergenic
1084266691 11:68008720-68008742 GGCCATGATGAGCACCTCCCAGG + Intronic
1084286360 11:68133769-68133791 GGGCAGGTAGCACACCACCCTGG + Intergenic
1084488668 11:69465808-69465830 GGACAGGTAATCCACCTCCCCGG - Intergenic
1087031051 11:93704601-93704623 GGCCTGGTAGTTCACCTACCAGG - Intronic
1089346663 11:117795801-117795823 GGCAGGGTTGGACCCCTCCCCGG + Intronic
1091178749 11:133584159-133584181 GAACAGATTGTACACCTGCCAGG - Intergenic
1095752432 12:45727798-45727820 GGCGAGCTTCTCCACCTCCCCGG + Intergenic
1095958296 12:47819028-47819050 GGACAGGATGTGCACCCCCCAGG - Intronic
1099086159 12:78248171-78248193 GGCCAGGATGTCCTCTTCCCTGG + Intergenic
1101878063 12:108608424-108608446 GGCCAGGCTGGTCACCTTCCTGG - Intergenic
1104144536 12:126019828-126019850 GGCCAGGTTTTACACCAGGCAGG + Intergenic
1104843501 12:131835474-131835496 GGCCAGGCTGCCCAGCTCCCTGG + Intronic
1120651076 14:87133550-87133572 GCCCAGGTGGTACACAGCCCTGG - Intergenic
1121011599 14:90523153-90523175 ACCCAGGTGCTACACCTCCCTGG - Intergenic
1121232202 14:92366178-92366200 GGCCAGGGTGTCCAGCACCCAGG - Intronic
1121730847 14:96186086-96186108 GACCAGGCAGTCCACCTCCCTGG + Intergenic
1130179842 15:81614212-81614234 GGCCAGTTTCTTTACCTCCCTGG - Intergenic
1133008896 16:2899367-2899389 GGGCAGGTTTTAAACATCCCAGG + Exonic
1135323712 16:21512986-21513008 GGCCAGGTTTTACACAGGCCTGG + Intergenic
1136020537 16:27437257-27437279 GCTCAGCTTGCACACCTCCCAGG - Intronic
1136335195 16:29606251-29606273 GGCCAGGTTTTACACAGGCCTGG + Intergenic
1138490467 16:57373347-57373369 GGCCAGTTTCTAAACCTCTCTGG - Intronic
1142035919 16:87862085-87862107 GGCCAGGTTTTACACAGGCCTGG + Intronic
1142467600 17:145125-145147 GGCCAGGTTAGACACCTCTGGGG + Intergenic
1142480364 17:215102-215124 GGGCAGGTTGGGCCCCTCCCTGG - Intronic
1145367175 17:22273971-22273993 GGCCAGGTGGTCCAGCCCCCAGG - Intergenic
1149991788 17:61387595-61387617 GGCCAGGATGGACAGCCCCCAGG - Intronic
1152307534 17:79529986-79530008 GGCCAGGTTGTAAATATTCCAGG - Intergenic
1152466739 17:80470927-80470949 GGCCAGGTTGTACACCTCCCCGG + Exonic
1157570863 18:48711252-48711274 GGCCAGGTTCTGCAGCTCACTGG - Intronic
1162328662 19:10013481-10013503 GGCCATGTTGATCCCCTCCCTGG - Exonic
1162447306 19:10731268-10731290 GGCCAGCTGGTAGGCCTCCCGGG - Intronic
925010622 2:482840-482862 GGCCAGGTTGGCTACCTCTCTGG + Intergenic
925364171 2:3299995-3300017 GGCCAGGCTGCATACCTCACTGG - Intronic
927857141 2:26534946-26534968 GGACAAGTTGTAAACTTCCCTGG - Intronic
932308940 2:70724532-70724554 GGCCAGGTTGCATGGCTCCCTGG + Intronic
933772047 2:85750807-85750829 TGCCAGGTTGCAGACCTTCCAGG - Intergenic
935112524 2:100105503-100105525 GGCCAGTTTGTCCCCCTTCCCGG - Exonic
938845532 2:135204997-135205019 GGACATATTGTACACATCCCAGG - Intronic
939221489 2:139307932-139307954 GAGCAGGTTGTTCACCTCCTAGG - Intergenic
941287330 2:163630459-163630481 GGCCAGGGTTTGCACCTGCCTGG - Intronic
944316573 2:198291402-198291424 GCCCAGCTTGTCCAGCTCCCAGG - Intronic
1168792693 20:590558-590580 GCCCAGGATGTTCCCCTCCCTGG - Intergenic
1168848249 20:959652-959674 GGCCAGGTTGTGACCCTCCACGG + Exonic
1172399811 20:34640158-34640180 GCCCAGGATGTACACATCCCGGG - Intronic
1175296124 20:57909941-57909963 GGGCAGGTTATCCACCTCTCTGG + Intergenic
1175540459 20:59744577-59744599 GGCCAGGTGTTACAGCGCCCAGG + Intronic
1175601891 20:60281119-60281141 AGCCAGGTAGGACACCTGCCAGG + Intergenic
1176040646 20:63064194-63064216 CCCCAGGTTGTGCAGCTCCCTGG - Intergenic
1176088934 20:63310406-63310428 GGCCAGGTTGTGCAGCTCCGTGG - Exonic
1181025183 22:20123716-20123738 GGCCAGGCTGGACCCCTCACAGG - Intronic
1181603136 22:23964127-23964149 GGCTAGGATGTCCCCCTCCCTGG - Intergenic
1181605377 22:23977180-23977202 GGCTAGGATGTCCCCCTCCCTGG + Intronic
1181627575 22:24132126-24132148 GACCAGGATGGACACCTGCCTGG + Intronic
1181632213 22:24157185-24157207 GGCCAGGTTGAACACCCCTAGGG - Intronic
1182241281 22:28918242-28918264 GGCCAGTTTACACTCCTCCCTGG + Intronic
1182705185 22:32272551-32272573 GTCCACGCTGTACACCTCCAGGG - Intergenic
1184257959 22:43297665-43297687 GGCCAAGAAGCACACCTCCCGGG - Intronic
1185168646 22:49278060-49278082 TGCCAGGCTGGACACCTGCCTGG + Intergenic
949909675 3:8891629-8891651 AGCCAGGCTGCACAGCTCCCTGG + Intronic
955040434 3:55312552-55312574 GGCCAGGTTTCAGAACTCCCTGG - Intergenic
956384608 3:68703397-68703419 GGCCAAGCTGCACACTTCCCTGG + Intergenic
958847261 3:99279352-99279374 GGCAAGGTCGTCCACGTCCCAGG - Intergenic
960206382 3:114905339-114905361 GGCCTGCTTGTATACATCCCTGG + Intronic
964888982 3:161516043-161516065 GCAGGGGTTGTACACCTCCCTGG - Intergenic
966871461 3:184292603-184292625 GTCCAGGAGGTACACCACCCAGG - Exonic
966951882 3:184827875-184827897 GGCCAGACTTTACACCTCCAGGG + Intronic
968662898 4:1806130-1806152 GTCGAGGTTGTGCACGTCCCGGG - Exonic
971822158 4:31571384-31571406 GGCCAGGTTATATATCTTCCTGG - Intergenic
976659717 4:87527253-87527275 GGCCTGGTTGGACATCTCTCAGG + Intronic
979288822 4:118957349-118957371 GGCCATGTTGCACATCTCACTGG + Intronic
987317069 5:16733779-16733801 GGCCAGGTTATTCCCATCCCCGG + Intronic
996702668 5:126465784-126465806 GGCCAGGGTGGACCCCTCTCTGG + Intronic
997528114 5:134566489-134566511 GGCCAGGTTGTCCACCTCGTCGG - Exonic
999220974 5:149977244-149977266 TCCCAGGTTTTTCACCTCCCAGG - Intronic
999442727 5:151615121-151615143 GGGCAGGCTGTACACCTCTAAGG - Intergenic
1001284297 5:170411186-170411208 GGCCAGGTGCTACAGCTCCTTGG + Intronic
1007746690 6:44047574-44047596 GGCCATTTTGCACACCTTCCAGG + Intergenic
1008048576 6:46876329-46876351 GGCCAGGTTTTTCACCTTTCGGG + Intronic
1011502309 6:88004652-88004674 GGCCAGGATTTACACCTTCTTGG - Intergenic
1016457279 6:144244641-144244663 GGCCAGGTTTAACCCCTACCTGG + Intergenic
1018953470 6:168393305-168393327 GGCCAGGTTTCTCACCTGCCTGG + Intergenic
1029612900 7:101636798-101636820 TTCCAGGTTATTCACCTCCCAGG - Intergenic
1032396110 7:131591219-131591241 GGCCAGGTGGTGCACATGCCTGG - Intergenic
1037917789 8:22783111-22783133 GGCCAGGTCTTGCACTTCCCTGG + Intronic
1046027570 8:108744052-108744074 GGAAATGTTGCACACCTCCCAGG - Intronic
1049773473 8:144394268-144394290 GTCCACGCTGTACACCTCCAGGG + Exonic
1050902731 9:10966724-10966746 CGCCGGGGTGTACACCTCCTTGG + Intergenic
1058734478 9:107881825-107881847 GGCCAGCTGGACCACCTCCCAGG + Intergenic
1058936528 9:109774271-109774293 GGCCAGGTTCTACTCCAGCCTGG - Intronic
1059545230 9:115169094-115169116 TACCAAGTTGTACACATCCCTGG - Intronic
1060200682 9:121650390-121650412 GGCCGGGTTTTGCACCTCACAGG - Intronic
1060880472 9:127114585-127114607 GTCCAGGTTGTAGTCCTGCCTGG + Intronic
1061671431 9:132190646-132190668 GGCCAGGTTGTAAACATCATAGG - Intronic
1185917323 X:4049607-4049629 GGCTAGGATCCACACCTCCCAGG + Intergenic
1186837832 X:13455633-13455655 GGCCAGGTTGTACCCTACCTTGG + Intergenic
1189019398 X:37318862-37318884 GGCCAGCTTGGACACTTCTCTGG + Intergenic
1189274267 X:39773346-39773368 GGCCTGATTGTTCACCTGCCTGG - Intergenic
1190876872 X:54466245-54466267 GGCCTGGTTGTACTCCTCATTGG + Intronic
1191150114 X:57211483-57211505 GGCCAGGTTGTAAAACTCCCAGG - Intergenic
1195588841 X:106600514-106600536 GGCCAGGTTCTAGACCTTCTAGG + Intergenic
1195598080 X:106715784-106715806 GTCCAAGTTGTATACCTACCTGG + Intronic
1195856636 X:109338923-109338945 GGCCAGGTTGTTCTCCACACAGG - Intergenic