ID: 1152467827

View in Genome Browser
Species Human (GRCh38)
Location 17:80475849-80475871
Sequence CCGCGGGGCCTCGCAGGCGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 218
Summary {0: 1, 1: 0, 2: 5, 3: 26, 4: 186}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152467818_1152467827 5 Left 1152467818 17:80475821-80475843 CCTGGCAGGGAGCTGGGGCGAGT 0: 1
1: 0
2: 2
3: 29
4: 371
Right 1152467827 17:80475849-80475871 CCGCGGGGCCTCGCAGGCGCGGG 0: 1
1: 0
2: 5
3: 26
4: 186
1152467810_1152467827 28 Left 1152467810 17:80475798-80475820 CCTCTGGGCGACTGCGGGGGCGG 0: 1
1: 0
2: 0
3: 13
4: 126
Right 1152467827 17:80475849-80475871 CCGCGGGGCCTCGCAGGCGCGGG 0: 1
1: 0
2: 5
3: 26
4: 186
1152467809_1152467827 29 Left 1152467809 17:80475797-80475819 CCCTCTGGGCGACTGCGGGGGCG 0: 1
1: 0
2: 0
3: 4
4: 71
Right 1152467827 17:80475849-80475871 CCGCGGGGCCTCGCAGGCGCGGG 0: 1
1: 0
2: 5
3: 26
4: 186
1152467808_1152467827 30 Left 1152467808 17:80475796-80475818 CCCCTCTGGGCGACTGCGGGGGC 0: 1
1: 0
2: 0
3: 8
4: 117
Right 1152467827 17:80475849-80475871 CCGCGGGGCCTCGCAGGCGCGGG 0: 1
1: 0
2: 5
3: 26
4: 186

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152467827 Original CRISPR CCGCGGGGCCTCGCAGGCGC GGG Intronic
900125542 1:1067499-1067521 GGGCAGGGCCTCGCGGGCGCAGG + Intergenic
900418722 1:2546493-2546515 CTGCGGGGCCAGGCAGGGGCGGG + Intergenic
900427451 1:2587030-2587052 CCGCGGGGCCTGGGCGGGGCTGG + Intronic
900562356 1:3313611-3313633 CCGCACGGCCTCGCAGGCGCAGG - Intronic
901793092 1:11664571-11664593 CCCCGGGGCCACCCAGGCGGAGG + Intronic
903055554 1:20633706-20633728 GCGCGGAGCCTCGCAGGGTCGGG + Exonic
903455431 1:23484010-23484032 CCGAGGGGCGGCGCTGGCGCGGG - Exonic
903652865 1:24931910-24931932 CCGCGCGCCCTCGGACGCGCTGG + Intronic
907484078 1:54764793-54764815 GGGCGGGGCCTGGCAGGGGCAGG - Intergenic
913231167 1:116741869-116741891 CTGCGGCGCCTCGCAGGCGCAGG - Intergenic
914980521 1:152410742-152410764 CTCTGGGGCCTCGCAGGAGCTGG - Exonic
917962346 1:180154981-180155003 CCGCGGGGCCGCGTTAGCGCCGG - Exonic
918048292 1:180954213-180954235 CCGCGGGGCCTCGCGCGGGCGGG + Intergenic
920666044 1:207963646-207963668 CCTCGGGTCTGCGCAGGCGCAGG + Intergenic
922200031 1:223393675-223393697 CCCCGCGGCCTCGCAGGCGCGGG + Exonic
922661172 1:227431744-227431766 CTCCGGGGCCTCGCTGGGGCTGG + Intergenic
922925128 1:229342153-229342175 GCGCGGGGCCCCGGAGGAGCAGG - Exonic
1063665893 10:8060385-8060407 CCACGGTGCCTGGCAGGGGCTGG + Intronic
1064028830 10:11870055-11870077 CAGCGGGGCCCGGCAGGCCCCGG - Exonic
1067474397 10:46556507-46556529 CGCCGGGGCCGCGCAGGCGGGGG + Intergenic
1067572929 10:47384666-47384688 CCGCGGGGCCTCGGCGATGCGGG + Intergenic
1067723639 10:48749867-48749889 CCACGAGGCCTGGCAGGGGCTGG - Intronic
1070835766 10:79445921-79445943 GGGCGGGGCCTCGCATGGGCGGG - Intergenic
1071618199 10:87095032-87095054 CGTCGGGGGCGCGCAGGCGCGGG + Intronic
1072926378 10:99620447-99620469 CCGCGGGGCCAAGCGGGAGCCGG - Intronic
1073210133 10:101793692-101793714 CCGCTGCGCTTCGCAGGCGCGGG + Intronic
1076024069 10:127098077-127098099 CCACGGTGCCTCCCAGGCACTGG - Intronic
1076908197 10:133373560-133373582 CGGCGGGGCCTGGAGGGCGCTGG - Exonic
1077269141 11:1666856-1666878 CCCCGGGGCCTCCCGGGCGGTGG - Intergenic
1077271406 11:1683858-1683880 CCCCGGGGCCTCCCGGGCGGTGG + Intergenic
1077360392 11:2138115-2138137 CCGCCGAGCCCCGCAGGCCCCGG + Intronic
1078090718 11:8263029-8263051 CCGCGGGGCCGCGCGGAGGCTGG - Intronic
1078222623 11:9364333-9364355 CAGCAGGGCCTCGCGGGCGGAGG + Intergenic
1080950772 11:37030134-37030156 CACCGGGGCCTCTCAGGGGCTGG - Intergenic
1081528520 11:43942875-43942897 CCGCCCGGCCCCGCAGACGCCGG + Exonic
1083432501 11:62621645-62621667 ATGCGGGGCCTTGCAGGCTCTGG + Intronic
1091550302 12:1531027-1531049 CCGCGGGGCCGGGAAGGCGGAGG - Intronic
1097029279 12:56079974-56079996 CCGCGGGGCGTGGCACGCTCGGG + Exonic
1101371862 12:104137964-104137986 GGGAGCGGCCTCGCAGGCGCGGG + Intronic
1102052421 12:109872351-109872373 CCTCGGGGCCTCTCAAGCTCAGG + Intronic
1102484761 12:113248169-113248191 CCGTGGGGCCTGGCAGGCCTCGG - Intronic
1103845399 12:123898764-123898786 CAGCAAGGCCTCGCAGGCGGCGG - Exonic
1104256881 12:127146761-127146783 CCTCTGGGACTCGCAGGCTCTGG - Intergenic
1104624355 12:130339201-130339223 CCGGGGGTCCTCGCGGGTGCTGG + Intronic
1105930427 13:25047265-25047287 GCGCGGGACCTCCCAGCCGCTGG + Intergenic
1107133459 13:36920133-36920155 CCGCCGGGCCCTGCAGGCGCTGG - Exonic
1108542044 13:51453569-51453591 ACTCGGGGCCTCGCGGGCGCCGG + Intronic
1113861639 13:113490915-113490937 GCGTGGGGCCTGGCAGCCGCAGG - Exonic
1117910851 14:60637431-60637453 CCAGGGGGCCTCGCCGGCACTGG - Intergenic
1118285259 14:64465367-64465389 GCGCGGGGCGGCGCGGGCGCCGG - Intronic
1119106847 14:71932684-71932706 CCGCGCGTCCTCGCGGGCCCGGG + Exonic
1122079122 14:99254633-99254655 CCCCAGGGCCTCGCTGGCCCCGG - Intronic
1122124791 14:99573149-99573171 CCGCGGGGACTCCGAGGCACCGG - Intronic
1122736589 14:103847210-103847232 CCGCGGGGGCTGGGAGCCGCGGG + Intronic
1124743132 15:32315373-32315395 CCTCGGGGCCGCGCCGGGGCCGG - Intergenic
1125220473 15:37327015-37327037 CCCCGGGGCCTGTCAGGGGCTGG - Intergenic
1126592706 15:50355451-50355473 CCCCGCTGCCGCGCAGGCGCCGG - Intergenic
1127512548 15:59657253-59657275 CCGCGGGGCCTTGCCGGCAACGG + Intronic
1129274007 15:74433708-74433730 CCGCGCGGCCGGTCAGGCGCGGG - Intronic
1129817237 15:78565694-78565716 CCGCGGTCCCGCGCGGGCGCGGG + Exonic
1130564526 15:84982078-84982100 CCGCGGCGGCCCGGAGGCGCCGG + Exonic
1131160606 15:90102470-90102492 ACGCTGGGCCTGGCGGGCGCTGG + Exonic
1131253326 15:90845215-90845237 CCAGGGGGCCTGGCAGGCCCTGG - Intergenic
1132778519 16:1610524-1610546 CCGCGGGGACTCGGCGGCGCCGG + Intronic
1132886667 16:2185233-2185255 CCGTGGGGCCAGGCAGGGGCCGG - Intronic
1133259256 16:4538001-4538023 CCGCGGGGCTCGGCAGGGGCTGG + Intronic
1133304360 16:4800418-4800440 CCGCGGGGCCTCCCTGGAGAGGG - Intronic
1138450661 16:57092177-57092199 CCCTGGGGCCCCGCAGGCCCGGG + Intergenic
1141430520 16:83968493-83968515 CCGCGGGGACTGGCCGGCGCCGG - Intergenic
1141481999 16:84313040-84313062 GCGCGCGGCCTGGCAGGCGCCGG - Exonic
1141929142 16:87189604-87189626 CCTCGGGGCCACCCAGGCACTGG - Intronic
1142298208 16:89240999-89241021 CCGCGGTGCCTCGCCGGCTTCGG + Intergenic
1143183434 17:4997689-4997711 CCGCGGGGGCACCCAGGCCCCGG - Intergenic
1145828165 17:27893065-27893087 CCGGGCGGCCTCGGAGGAGCAGG - Intronic
1146057711 17:29589470-29589492 CGCCGGGGCCTCGCCGGAGCCGG - Exonic
1146774032 17:35596583-35596605 CCGCCGGGCCTGGCAGGCGCGGG - Intronic
1149347273 17:55751268-55751290 CCGCGGGGCCTAGAATGCGCCGG + Intronic
1149430665 17:56593924-56593946 CCGCGGGGCGCGGGAGGCGCCGG - Exonic
1149994810 17:61400844-61400866 CCGCGGGGCCTCCTCTGCGCTGG - Intronic
1151783787 17:76265440-76265462 ACGCGGGGCTGCGCGGGCGCGGG - Exonic
1152049225 17:77959215-77959237 CCGCGGGGCTCCGGTGGCGCGGG - Intergenic
1152467827 17:80475849-80475871 CCGCGGGGCCTCGCAGGCGCGGG + Intronic
1152739386 17:82012365-82012387 AGGAGGGGCCTGGCAGGCGCTGG + Intronic
1153226947 18:2906839-2906861 CCGCTGGGCCTCGGCGGGGCGGG - Exonic
1154125598 18:11689620-11689642 CTGCGCGGCCTCGGAGCCGCCGG + Exonic
1154954680 18:21242402-21242424 CCGCGGGGACTCCGGGGCGCGGG + Intronic
1158202876 18:54959490-54959512 CCCCGGGGCCTCACCGGCGCCGG - Exonic
1158259073 18:55588008-55588030 CCGCCGAGCCCCGCAGGCGCCGG + Intronic
1158478866 18:57803338-57803360 CCGCCGAGCCTCGCTGGGGCTGG + Intergenic
1158931074 18:62325438-62325460 CCGCGCGGCCCGGCAGGCGCGGG - Intronic
1159586890 18:70289688-70289710 CCGCGAGGTCGCGCCGGCGCTGG + Intronic
1160204583 18:76822526-76822548 CGGCGGGGGCGCGCACGCGCGGG - Intergenic
1160411661 18:78679195-78679217 CCCAGGGACCTCGCAGGCGCTGG - Intergenic
1160824922 19:1074996-1075018 CTGCGAGGCCGCGCATGCGCAGG - Intronic
1160853607 19:1206198-1206220 GTGCGGGCCCTCGCGGGCGCCGG + Intronic
1160968604 19:1757571-1757593 CCGCGCGGCCCCGCGGCCGCGGG + Intronic
1161672803 19:5623527-5623549 CTCCGGGGCCTCGGAGGAGCCGG - Intronic
1161802655 19:6424589-6424611 CCGCCGGGCCCGCCAGGCGCGGG - Exonic
1162143866 19:8601076-8601098 CCCAGGGGCCTGGCAGGCGGTGG + Exonic
1162744297 19:12790200-12790222 CCGCGGGGGCTCGCACGCCCAGG + Intronic
1163103253 19:15109810-15109832 CCCGGGGGCCTCGCAGGCTCAGG - Exonic
1163118071 19:15200167-15200189 CCGCGGGGACCCGGAGGCCCTGG - Intronic
1163442253 19:17328130-17328152 GGGCGGGGCCTCGCAGGGGGCGG - Intronic
1163573548 19:18097730-18097752 CGGCGGGGCCTGGCAGGCCGGGG + Intronic
1163584373 19:18155981-18156003 CCGGGCGGCCTTGCAGGCGCTGG + Exonic
1163664470 19:18596820-18596842 GGGCGGGGCCTAGCAGGAGCGGG + Intronic
1165871411 19:38975803-38975825 CCGCTGGGCCCCGCAGCCGGAGG - Exonic
1167045320 19:47045955-47045977 CCGTGGGGCCTGGCAGGCGCTGG - Exonic
1168075332 19:53978270-53978292 TCGCGGGGCCTGGAAGGCGTCGG + Intronic
925394081 2:3519615-3519637 CCGTGGGGCCTCCCCCGCGCCGG - Exonic
927053421 2:19350618-19350640 CCGCGGGACCGCGCAGGCGGTGG - Intergenic
932152700 2:69387363-69387385 CCCCGAGCCCACGCAGGCGCTGG + Intergenic
932313896 2:70767412-70767434 CCCCGGGGCCTCGCGATCGCTGG - Intronic
934655308 2:96114258-96114280 TCGCGGTCCCTGGCAGGCGCTGG - Exonic
934993333 2:98936370-98936392 CCGCGGGGCGTCCAAGGCCCAGG - Intergenic
938080941 2:128369813-128369835 CCACGGGGCATTGCAGGCTCCGG - Intergenic
938368808 2:130756197-130756219 CCGCGGGGTCGGGCAGGCGAGGG - Intronic
938407302 2:131039692-131039714 CCGCTGGGGCTGGCAGGAGCAGG + Intronic
938949552 2:136244166-136244188 CCTCAGGGCCTCGCTGGAGCTGG - Intergenic
940009522 2:149038949-149038971 CCGCGGGGCCGCGGGGCCGCGGG + Intronic
941008365 2:160270320-160270342 CCGCGGGGCCCCCCGGGCGCAGG - Intronic
944221729 2:197310420-197310442 CCGCGGGCTCTCGGAGGCACCGG + Intronic
946431069 2:219627714-219627736 CGCCTGGGCCTCGCAGGCTCCGG + Exonic
948945690 2:241217953-241217975 CAGCGGGGGCGCGCAGGGGCGGG + Intronic
948945704 2:241217983-241218005 CAGCGGGGGCGCGCAGGGGCGGG + Intronic
948945749 2:241218072-241218094 CAGCGGGGGCGCGCAGGGGCGGG + Intronic
1172109330 20:32536269-32536291 CCGCGGGGCCTGGCTGGCTCAGG - Intronic
1173251092 20:41364641-41364663 CAGGGGGGCCTGGCAGGCCCAGG - Intronic
1173322256 20:41998689-41998711 CTGCGGCGCCGCGCAGGTGCAGG - Intergenic
1173605244 20:44326935-44326957 GCGCGGGGCCCCGCAGTCCCGGG - Intergenic
1174404987 20:50297032-50297054 CCGAGGGGCCTGGCAGGGGGTGG - Intergenic
1176157040 20:63627110-63627132 CGGCGGGGCCGCGCACGCACGGG + Intergenic
1176547649 21:8208554-8208576 GCGCGGGGCCTCACCGCCGCCGG - Intergenic
1176550031 21:8217039-8217061 CCGCGGGGCCCCGGCGGCGGGGG + Intergenic
1176566600 21:8391601-8391623 GCGCGGGGCCTCACCGCCGCCGG - Intergenic
1176568958 21:8400074-8400096 CCGCGGGGCCCCGGCGGCGGGGG + Intergenic
1176574475 21:8435788-8435810 GCGCGGGGCCTCACCGCCGCCGG - Intergenic
1176576872 21:8444309-8444331 CCGCGGGGCCCCGGCGGCGGGGG + Intergenic
1176611088 21:8987080-8987102 GCGCGGGGCCTCACCGCCGCCGG - Intergenic
1177871042 21:26573114-26573136 CCGCGGAGTCCCGCAGTCGCTGG - Exonic
1180109724 21:45642444-45642466 CCGCGGGTCCTCGCCGGGGTGGG - Intergenic
1180110267 21:45644036-45644058 CCCCGGGCCGCCGCAGGCGCCGG - Intronic
1180181516 21:46120521-46120543 CCGCGGGGCCCCTCAGGGCCAGG - Exonic
1180232670 21:46436716-46436738 CCACGGGGCCTGGCAGGCGGTGG + Intronic
1181057547 22:20267371-20267393 CCGCGGGACCTCACAGCCGGTGG + Intronic
1183601562 22:38843341-38843363 CCGCGCGGCCTCCAGGGCGCCGG - Exonic
1183903347 22:41022188-41022210 GCGCGGGGCGGCGGAGGCGCGGG + Intergenic
1183931478 22:41238264-41238286 CGGCGGGGCCCTGCAGGCCCTGG - Exonic
1184759486 22:46536742-46536764 CTGCGCGGCCGCGCAGCCGCCGG + Exonic
1203252523 22_KI270733v1_random:124839-124861 GCGCGGGGCCTCACCGCCGCCGG - Intergenic
1203254921 22_KI270733v1_random:133365-133387 CCGCGGGGCCCCGGCGGCGGGGG + Intergenic
1203260579 22_KI270733v1_random:169925-169947 GCGCGGGGCCTCACCGCCGCCGG - Intergenic
1203262977 22_KI270733v1_random:178444-178466 CCGCGGGGCCCCGGCGGCGGGGG + Intergenic
956129111 3:66038120-66038142 CCTCGGGCCCTCGCCGCCGCCGG + Exonic
956406403 3:68932631-68932653 CCGCGGGGCCAGGCAGGGACAGG - Intergenic
961523111 3:127479506-127479528 CCGTGGGGCCTGGCTGGCCCTGG + Intergenic
962738864 3:138348665-138348687 CCGCCGGGCCCCGCGGCCGCCGG - Intronic
963746451 3:149129540-149129562 CCGCGGGGCGTGGCAGGCGTCGG - Intergenic
967814558 3:193788011-193788033 GCGAGGGGCCTGGCAGGGGCTGG + Intergenic
968093041 3:195909767-195909789 CCCCGGGGCGGCGCAGGCGCAGG - Intronic
968199511 3:196740117-196740139 CCGAGGCGCCTCGCTGGGGCGGG + Exonic
968512479 4:1001734-1001756 CGCCGGGGCCTCCCAGCCGCAGG - Exonic
969714399 4:8861299-8861321 ACGCGGGGCCTGGGAGGGGCGGG + Intronic
974047461 4:56908946-56908968 CCGCGGAGCCTCCCCGGCCCTGG + Intronic
975473231 4:74794138-74794160 GCGCTGGGGCTGGCAGGCGCGGG - Intronic
978778358 4:112524102-112524124 CCGCGGGGCTTCGGGGCCGCGGG + Intergenic
985471802 5:51139-51161 CCGCGGAGGCTCGGAGGGGCCGG + Intergenic
985490062 5:174114-174136 CCGCAGGGCCTGCCAGGCTCAGG + Intronic
986315325 5:6583118-6583140 CCGCGGCGCCGCGCAGGACCCGG + Intergenic
995735481 5:115296293-115296315 GCTCGGGGCCTGGCACGCGCTGG - Intronic
997984430 5:138491823-138491845 CCCCGGGCCCTCGCAGTTGCAGG - Intergenic
1003062832 6:2876089-2876111 CCGCGGGGCAGCGCGGGCGCGGG + Intergenic
1006983271 6:38162307-38162329 CCGCGGGGCCTGGAAGGGGCAGG - Intergenic
1015994926 6:138987885-138987907 GCGCCGGGCCTCGCAGGCAGCGG - Exonic
1016713990 6:147203711-147203733 CAGCAGGGCCTCCCAGGAGCCGG - Intergenic
1019143039 6:169960215-169960237 CCTCAGGGCCTCCCAGGGGCTGG + Intergenic
1019379182 7:712356-712378 CCGGGGGGCCTCCCAGGCCCGGG + Intronic
1019561956 7:1663924-1663946 CCGCGGGGCCTGGCTGGCCTCGG - Intergenic
1019644397 7:2121329-2121351 CCACGGTGCCTGGCAGGTGCTGG - Intronic
1021313215 7:19117335-19117357 ACGCGTGGCCTCGCGGGCCCGGG + Exonic
1021998512 7:26202200-26202222 CCGCCAGGCCTCGCGGACGCGGG - Intronic
1022360202 7:29649943-29649965 GCGCGGGGCCTCCCAAGCCCAGG + Intergenic
1024970914 7:55069477-55069499 CCATGGGGCCTCACAGGCCCTGG + Intronic
1030470668 7:109959011-109959033 CAGCGGGGCCTGTCAGGGGCTGG + Intergenic
1031986628 7:128167944-128167966 ACGCGGGGCCTCCCACGCACAGG + Intergenic
1035125826 7:156607387-156607409 CCGCGAGGCCTCAGAGGCGCTGG - Intergenic
1035254184 7:157615566-157615588 CCGCGGGACTTCCCAGGCGCTGG - Exonic
1035729168 8:1842484-1842506 CCGCCTGGCCTCGGAGGAGCTGG + Intronic
1036815832 8:11902376-11902398 GCGCCGGGCCCCGCAGCCGCTGG - Intergenic
1036910581 8:12754704-12754726 TCGCAGCGCCTCGCAGGCGGCGG + Exonic
1039885106 8:41650060-41650082 CCCCGGGGCCTGGCGGGTGCCGG + Intronic
1042246410 8:66712822-66712844 CCGCGGGGCCAGGTAGGTGCGGG + Intronic
1044734943 8:95269318-95269340 CCGCGAGCCCTCGTGGGCGCCGG - Intergenic
1049162064 8:141103925-141103947 CCGCGGGGCCTCGGGGAGGCCGG + Intergenic
1049396544 8:142403534-142403556 CTGCGGGGCTGCGCAGGCGGCGG + Intergenic
1049396581 8:142403660-142403682 CCGCGGGGCCTGCCAGCCCCCGG - Intergenic
1049419547 8:142510758-142510780 CCGCGGGGCCTGGCGGCGGCGGG + Intronic
1049939839 9:535016-535038 CTGCTGGGCCTCGCAGCCGTGGG + Intronic
1053003368 9:34589871-34589893 GCGCGCGGCCGCGGAGGCGCGGG - Intronic
1053198267 9:36136453-36136475 ACCCGGGGCCCAGCAGGCGCGGG + Intergenic
1055513073 9:77014202-77014224 GCGCCGGGCCGCGCAGGCTCAGG - Intergenic
1056135169 9:83623508-83623530 CTGCGGGGCCGCGCAGGTGGAGG + Intronic
1060514579 9:124257933-124257955 GCGCGGGCCCGCGCAGGCGGTGG + Intronic
1061375323 9:130220540-130220562 CCACTGGGCCTCGCACACGCGGG - Intronic
1061965713 9:134012630-134012652 CCGCGGTGTATCGCAGTCGCGGG - Intergenic
1061965718 9:134012654-134012676 CCGCGGTGTATCGCAGTCGCGGG - Intergenic
1061965723 9:134012678-134012700 CCGCGGTGTATCGCAGTCGCGGG - Intergenic
1062272235 9:135714808-135714830 CCGCGCGCCCCCGCAGCCGCCGG + Intronic
1062463632 9:136671955-136671977 CAGCCTGGCCTCGCAGGCACTGG + Exonic
1062537727 9:137028218-137028240 CCGCTGGGCATCGCCCGCGCGGG + Intronic
1062560470 9:137139385-137139407 CCGCGGGGCCGGGCGAGCGCAGG + Intronic
1062564177 9:137156601-137156623 CCGCGGCGCTCCGCAGGCCCAGG - Intronic
1062616186 9:137397044-137397066 CCGCGGGTCCTGGGAGGCTCGGG - Intronic
1203468926 Un_GL000220v1:107990-108012 GCGCGGGGCCTCACCGCCGCCGG - Intergenic
1203471323 Un_GL000220v1:116511-116533 CCGCGGGGCCCCGGCGGCGGGGG + Intergenic
1203476747 Un_GL000220v1:151962-151984 GCGCGGGGCCTCACCGCCGCCGG - Intergenic
1203479144 Un_GL000220v1:160483-160505 CCGCGGGGCCCCGGCGGCGGGGG + Intergenic
1187900905 X:24025748-24025770 ACGCGGGGCGCCGCGGGCGCGGG - Intronic