ID: 1152467890

View in Genome Browser
Species Human (GRCh38)
Location 17:80476060-80476082
Sequence CGTCTCGGCGGCCGGTGTCC GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 65
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 61}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152467884_1152467890 -8 Left 1152467884 17:80476045-80476067 CCCGAGTTGGCTGAGCGTCTCGG 0: 1
1: 0
2: 0
3: 0
4: 34
Right 1152467890 17:80476060-80476082 CGTCTCGGCGGCCGGTGTCCGGG 0: 1
1: 0
2: 0
3: 3
4: 61
1152467882_1152467890 23 Left 1152467882 17:80476014-80476036 CCAGGCGGGTTTTGAGCGATTGC 0: 1
1: 0
2: 0
3: 2
4: 37
Right 1152467890 17:80476060-80476082 CGTCTCGGCGGCCGGTGTCCGGG 0: 1
1: 0
2: 0
3: 3
4: 61
1152467886_1152467890 -9 Left 1152467886 17:80476046-80476068 CCGAGTTGGCTGAGCGTCTCGGC 0: 1
1: 0
2: 0
3: 3
4: 42
Right 1152467890 17:80476060-80476082 CGTCTCGGCGGCCGGTGTCCGGG 0: 1
1: 0
2: 0
3: 3
4: 61

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152467890 Original CRISPR CGTCTCGGCGGCCGGTGTCC GGG Exonic
900244577 1:1631299-1631321 CGACGGGGCGGCCGGCGTCCAGG - Intergenic
900283917 1:1890505-1890527 CGTGGCGGCGGCCGGGGCCCCGG - Intronic
900360112 1:2284267-2284289 CGTCTCGGCAGCATGGGTCCAGG - Intronic
900654235 1:3747166-3747188 ACTCTCGGCGGCCGGTGGACGGG + Intergenic
903682532 1:25106804-25106826 TGTCTGGGTGGCCTGTGTCCTGG - Intergenic
905442650 1:38005179-38005201 AGTCCCGGCGGGCGCTGTCCCGG + Intronic
905584516 1:39105997-39106019 CCCCACGGCGGCCGGTCTCCAGG - Intronic
915020696 1:152776352-152776374 CATCTCGGTGGCGGGTGTTCAGG - Exonic
915025657 1:152827453-152827475 CATCTCGGCGGTGGGTGTTCAGG - Exonic
915358793 1:155273254-155273276 CGACACTGCGGCCGGAGTCCCGG + Exonic
1062854345 10:772286-772308 CCTCCCGGCGGCCGCTGCCCAGG + Intergenic
1073249798 10:102114592-102114614 CCCCGCGGCGGCCGCTGTCCCGG + Intronic
1075399292 10:122149918-122149940 CGTCTCACCGGCCGGTGACGTGG - Intronic
1081856100 11:46304908-46304930 CTTCCCGGAGGCCGGTGGCCAGG + Intronic
1097245939 12:57607589-57607611 CGTCTTCCCGCCCGGTGTCCAGG + Exonic
1098342977 12:69470625-69470647 GGGCTCGGCTGCCGGCGTCCGGG + Intronic
1105240026 13:18600083-18600105 GGTGTCGGCGGGCGGAGTCCGGG + Intergenic
1105943610 13:25171446-25171468 CGGCTCGGCGGCCGGCGTTTCGG + Exonic
1119506448 14:75176974-75176996 CGCCTAGGCGGCCGGTGGGCGGG - Intergenic
1123491209 15:20783984-20784006 GGTGTCGGCGGGCGGAGTCCCGG - Intergenic
1123547710 15:21353075-21353097 GGTGTCGGCGGGCGGAGTCCGGG - Intergenic
1124922172 15:34038447-34038469 AGTCTCGGCGGCCCGTGGGCCGG - Intronic
1128454185 15:67823445-67823467 CATCTCCGCGCCCGGGGTCCCGG + Intronic
1132364989 15:101251075-101251097 CATCCCGGCGGCCGGCATCCCGG - Intronic
1202956040 15_KI270727v1_random:80305-80327 GGTGTCGGCGGGCGGAGTCCGGG - Intergenic
1135424058 16:22323626-22323648 CCTCTGGGCAGTCGGTGTCCAGG + Intronic
1137531752 16:49282382-49282404 GGTCCCGGCGGCCGGGGTGCAGG + Intergenic
1142474557 17:181323-181345 CGGCTCGGGGCCCGGCGTCCGGG + Exonic
1147179369 17:38674685-38674707 CCTCCCGGCGGCCGGACTCCTGG + Exonic
1148108883 17:45133307-45133329 CGTTTCTGCGGCCGGTGGCCTGG + Intronic
1152467890 17:80476060-80476082 CGTCTCGGCGGCCGGTGTCCGGG + Exonic
1153805719 18:8706722-8706744 CGCCTCGGCCGCAGGTGTCCCGG + Intronic
1154448806 18:14458691-14458713 GGTGTCGGCGGGCGGAGTCCGGG - Intergenic
1160540371 18:79617432-79617454 CGTCCCGGGGGGCGGGGTCCCGG - Intergenic
1161309438 19:3585831-3585853 GGTCTTGGGCGCCGGTGTCCGGG - Intronic
1162773606 19:12965467-12965489 CCTCTGGGAGGCGGGTGTCCTGG + Intronic
934566971 2:95346583-95346605 CGGCGCGGCGGCGGGGGTCCCGG - Intronic
937407565 2:121644649-121644671 CGTCTTGGGGGCCGGTGTAGGGG + Intronic
938482679 2:131674163-131674185 GGTGTCGGCGGGCGGAGTCCGGG + Intergenic
938909858 2:135876170-135876192 CGTGTGGGCGGCGGGTGTTCCGG - Intronic
948257879 2:236581179-236581201 CATCTCGGCGTCCAGTGACCAGG + Exonic
1171011796 20:21513074-21513096 CCTCCCAGCGGCCGGAGTCCGGG + Intronic
1176067312 20:63204920-63204942 CGTCTCACCGGCCTGTGTACAGG - Intronic
1176145777 20:63564816-63564838 CCTCTCGGCGGCCGGCAACCCGG + Exonic
1184827925 22:46965734-46965756 CGTCCCTGTGGCCGGTGGCCTGG + Intronic
953397087 3:42581933-42581955 CGCCTGGGCTGCCGGTGACCTGG - Exonic
969873163 4:10116933-10116955 CGGCTCGGCGGCTGCGGTCCCGG + Intronic
980378431 4:131977805-131977827 CGCCTGGGAGGCCGTTGTCCTGG + Intergenic
1003065875 6:2903248-2903270 CGCCTCGGGGGTCGGCGTCCAGG - Exonic
1006770301 6:36547422-36547444 CGTCTCCGCGGCGGGGGACCGGG - Exonic
1019279396 7:192554-192576 CCTCTCGGCGCCCCGCGTCCCGG - Intergenic
1019896981 7:3990291-3990313 CATCTCTGAGGCCGGAGTCCAGG + Intronic
1020418172 7:7969313-7969335 CGTGTCGGCCGGCGGCGTCCAGG + Exonic
1028621425 7:92833328-92833350 CGCCGCGGCGGGCGGCGTCCAGG - Exonic
1029112201 7:98218102-98218124 CGGCCCGGCAGCCGGTGGCCAGG + Intronic
1029728481 7:102424320-102424342 CGTGCCTGCGGCCGGCGTCCTGG + Intronic
1041352008 8:56956536-56956558 TGTCTAGGTGGCCGGTGTTCTGG - Intergenic
1049302832 8:141880639-141880661 AGTCTCAGAGGCCAGTGTCCAGG - Intergenic
1049628223 8:143636223-143636245 CCTCTCGGCGGACTGTGCCCTGG - Intronic
1051171615 9:14322861-14322883 CGTCTCGGGGGCTGCTGCCCAGG + Intronic
1057076599 9:92141418-92141440 CATCTCGGCGGCCGGGCTGCTGG - Intergenic
1058843509 9:108933804-108933826 CCTCTCCGCCGGCGGTGTCCGGG - Intronic
1060770308 9:126327202-126327224 CGCCGCGGCTGCCGGTGCCCGGG + Intronic
1060792245 9:126494313-126494335 CTTCTCGGCAGCCAGTGTCCTGG + Intronic
1061626353 9:131842802-131842824 CGTCTCGGGGGCAGGCGGCCCGG - Intergenic