ID: 1152474498

View in Genome Browser
Species Human (GRCh38)
Location 17:80509208-80509230
Sequence TGTAGAGAGGGAGACGAGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152474498_1152474506 9 Left 1152474498 17:80509208-80509230 CCAACCTCGTCTCCCTCTCTACA No data
Right 1152474506 17:80509240-80509262 ACTTAAAATGGCCAAGACAGGGG No data
1152474498_1152474504 7 Left 1152474498 17:80509208-80509230 CCAACCTCGTCTCCCTCTCTACA No data
Right 1152474504 17:80509238-80509260 CCACTTAAAATGGCCAAGACAGG No data
1152474498_1152474502 -3 Left 1152474498 17:80509208-80509230 CCAACCTCGTCTCCCTCTCTACA No data
Right 1152474502 17:80509228-80509250 ACAGACTTCTCCACTTAAAATGG No data
1152474498_1152474511 25 Left 1152474498 17:80509208-80509230 CCAACCTCGTCTCCCTCTCTACA No data
Right 1152474511 17:80509256-80509278 ACAGGGGCTGCCTTTTCTGGGGG No data
1152474498_1152474509 23 Left 1152474498 17:80509208-80509230 CCAACCTCGTCTCCCTCTCTACA No data
Right 1152474509 17:80509254-80509276 AGACAGGGGCTGCCTTTTCTGGG No data
1152474498_1152474505 8 Left 1152474498 17:80509208-80509230 CCAACCTCGTCTCCCTCTCTACA No data
Right 1152474505 17:80509239-80509261 CACTTAAAATGGCCAAGACAGGG No data
1152474498_1152474508 22 Left 1152474498 17:80509208-80509230 CCAACCTCGTCTCCCTCTCTACA No data
Right 1152474508 17:80509253-80509275 AAGACAGGGGCTGCCTTTTCTGG No data
1152474498_1152474510 24 Left 1152474498 17:80509208-80509230 CCAACCTCGTCTCCCTCTCTACA No data
Right 1152474510 17:80509255-80509277 GACAGGGGCTGCCTTTTCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152474498 Original CRISPR TGTAGAGAGGGAGACGAGGT TGG (reversed) Intergenic