ID: 1152474499

View in Genome Browser
Species Human (GRCh38)
Location 17:80509212-80509234
Sequence AGTCTGTAGAGAGGGAGACG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152474499_1152474509 19 Left 1152474499 17:80509212-80509234 CCTCGTCTCCCTCTCTACAGACT No data
Right 1152474509 17:80509254-80509276 AGACAGGGGCTGCCTTTTCTGGG No data
1152474499_1152474513 28 Left 1152474499 17:80509212-80509234 CCTCGTCTCCCTCTCTACAGACT No data
Right 1152474513 17:80509263-80509285 CTGCCTTTTCTGGGGGTTCTGGG No data
1152474499_1152474512 27 Left 1152474499 17:80509212-80509234 CCTCGTCTCCCTCTCTACAGACT No data
Right 1152474512 17:80509262-80509284 GCTGCCTTTTCTGGGGGTTCTGG No data
1152474499_1152474506 5 Left 1152474499 17:80509212-80509234 CCTCGTCTCCCTCTCTACAGACT No data
Right 1152474506 17:80509240-80509262 ACTTAAAATGGCCAAGACAGGGG No data
1152474499_1152474514 29 Left 1152474499 17:80509212-80509234 CCTCGTCTCCCTCTCTACAGACT No data
Right 1152474514 17:80509264-80509286 TGCCTTTTCTGGGGGTTCTGGGG No data
1152474499_1152474502 -7 Left 1152474499 17:80509212-80509234 CCTCGTCTCCCTCTCTACAGACT No data
Right 1152474502 17:80509228-80509250 ACAGACTTCTCCACTTAAAATGG No data
1152474499_1152474508 18 Left 1152474499 17:80509212-80509234 CCTCGTCTCCCTCTCTACAGACT No data
Right 1152474508 17:80509253-80509275 AAGACAGGGGCTGCCTTTTCTGG No data
1152474499_1152474504 3 Left 1152474499 17:80509212-80509234 CCTCGTCTCCCTCTCTACAGACT No data
Right 1152474504 17:80509238-80509260 CCACTTAAAATGGCCAAGACAGG No data
1152474499_1152474510 20 Left 1152474499 17:80509212-80509234 CCTCGTCTCCCTCTCTACAGACT No data
Right 1152474510 17:80509255-80509277 GACAGGGGCTGCCTTTTCTGGGG No data
1152474499_1152474505 4 Left 1152474499 17:80509212-80509234 CCTCGTCTCCCTCTCTACAGACT No data
Right 1152474505 17:80509239-80509261 CACTTAAAATGGCCAAGACAGGG No data
1152474499_1152474511 21 Left 1152474499 17:80509212-80509234 CCTCGTCTCCCTCTCTACAGACT No data
Right 1152474511 17:80509256-80509278 ACAGGGGCTGCCTTTTCTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152474499 Original CRISPR AGTCTGTAGAGAGGGAGACG AGG (reversed) Intergenic