ID: 1152474501

View in Genome Browser
Species Human (GRCh38)
Location 17:80509221-80509243
Sequence AAGTGGAGAAGTCTGTAGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152474501_1152474508 9 Left 1152474501 17:80509221-80509243 CCTCTCTACAGACTTCTCCACTT No data
Right 1152474508 17:80509253-80509275 AAGACAGGGGCTGCCTTTTCTGG No data
1152474501_1152474514 20 Left 1152474501 17:80509221-80509243 CCTCTCTACAGACTTCTCCACTT No data
Right 1152474514 17:80509264-80509286 TGCCTTTTCTGGGGGTTCTGGGG No data
1152474501_1152474510 11 Left 1152474501 17:80509221-80509243 CCTCTCTACAGACTTCTCCACTT No data
Right 1152474510 17:80509255-80509277 GACAGGGGCTGCCTTTTCTGGGG No data
1152474501_1152474505 -5 Left 1152474501 17:80509221-80509243 CCTCTCTACAGACTTCTCCACTT No data
Right 1152474505 17:80509239-80509261 CACTTAAAATGGCCAAGACAGGG No data
1152474501_1152474506 -4 Left 1152474501 17:80509221-80509243 CCTCTCTACAGACTTCTCCACTT No data
Right 1152474506 17:80509240-80509262 ACTTAAAATGGCCAAGACAGGGG No data
1152474501_1152474516 29 Left 1152474501 17:80509221-80509243 CCTCTCTACAGACTTCTCCACTT No data
Right 1152474516 17:80509273-80509295 TGGGGGTTCTGGGGTATTCCTGG No data
1152474501_1152474513 19 Left 1152474501 17:80509221-80509243 CCTCTCTACAGACTTCTCCACTT No data
Right 1152474513 17:80509263-80509285 CTGCCTTTTCTGGGGGTTCTGGG No data
1152474501_1152474512 18 Left 1152474501 17:80509221-80509243 CCTCTCTACAGACTTCTCCACTT No data
Right 1152474512 17:80509262-80509284 GCTGCCTTTTCTGGGGGTTCTGG No data
1152474501_1152474517 30 Left 1152474501 17:80509221-80509243 CCTCTCTACAGACTTCTCCACTT No data
Right 1152474517 17:80509274-80509296 GGGGGTTCTGGGGTATTCCTGGG No data
1152474501_1152474509 10 Left 1152474501 17:80509221-80509243 CCTCTCTACAGACTTCTCCACTT No data
Right 1152474509 17:80509254-80509276 AGACAGGGGCTGCCTTTTCTGGG No data
1152474501_1152474504 -6 Left 1152474501 17:80509221-80509243 CCTCTCTACAGACTTCTCCACTT No data
Right 1152474504 17:80509238-80509260 CCACTTAAAATGGCCAAGACAGG No data
1152474501_1152474511 12 Left 1152474501 17:80509221-80509243 CCTCTCTACAGACTTCTCCACTT No data
Right 1152474511 17:80509256-80509278 ACAGGGGCTGCCTTTTCTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152474501 Original CRISPR AAGTGGAGAAGTCTGTAGAG AGG (reversed) Intergenic