ID: 1152474503

View in Genome Browser
Species Human (GRCh38)
Location 17:80509238-80509260
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 15 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152474503_1152474518 14 Left 1152474503 17:80509238-80509260 CCACTTAAAATGGCCAAGACAGG No data
Right 1152474518 17:80509275-80509297 GGGGTTCTGGGGTATTCCTGGGG No data
1152474503_1152474509 -7 Left 1152474503 17:80509238-80509260 CCACTTAAAATGGCCAAGACAGG No data
Right 1152474509 17:80509254-80509276 AGACAGGGGCTGCCTTTTCTGGG No data
1152474503_1152474517 13 Left 1152474503 17:80509238-80509260 CCACTTAAAATGGCCAAGACAGG No data
Right 1152474517 17:80509274-80509296 GGGGGTTCTGGGGTATTCCTGGG No data
1152474503_1152474514 3 Left 1152474503 17:80509238-80509260 CCACTTAAAATGGCCAAGACAGG No data
Right 1152474514 17:80509264-80509286 TGCCTTTTCTGGGGGTTCTGGGG No data
1152474503_1152474522 29 Left 1152474503 17:80509238-80509260 CCACTTAAAATGGCCAAGACAGG No data
Right 1152474522 17:80509290-80509312 TCCTGGGGGAGATCAAGGCTGGG No data
1152474503_1152474511 -5 Left 1152474503 17:80509238-80509260 CCACTTAAAATGGCCAAGACAGG No data
Right 1152474511 17:80509256-80509278 ACAGGGGCTGCCTTTTCTGGGGG No data
1152474503_1152474516 12 Left 1152474503 17:80509238-80509260 CCACTTAAAATGGCCAAGACAGG No data
Right 1152474516 17:80509273-80509295 TGGGGGTTCTGGGGTATTCCTGG No data
1152474503_1152474521 28 Left 1152474503 17:80509238-80509260 CCACTTAAAATGGCCAAGACAGG No data
Right 1152474521 17:80509289-80509311 TTCCTGGGGGAGATCAAGGCTGG No data
1152474503_1152474510 -6 Left 1152474503 17:80509238-80509260 CCACTTAAAATGGCCAAGACAGG No data
Right 1152474510 17:80509255-80509277 GACAGGGGCTGCCTTTTCTGGGG No data
1152474503_1152474519 15 Left 1152474503 17:80509238-80509260 CCACTTAAAATGGCCAAGACAGG No data
Right 1152474519 17:80509276-80509298 GGGTTCTGGGGTATTCCTGGGGG No data
1152474503_1152474524 30 Left 1152474503 17:80509238-80509260 CCACTTAAAATGGCCAAGACAGG No data
Right 1152474524 17:80509291-80509313 CCTGGGGGAGATCAAGGCTGGGG No data
1152474503_1152474512 1 Left 1152474503 17:80509238-80509260 CCACTTAAAATGGCCAAGACAGG No data
Right 1152474512 17:80509262-80509284 GCTGCCTTTTCTGGGGGTTCTGG No data
1152474503_1152474520 24 Left 1152474503 17:80509238-80509260 CCACTTAAAATGGCCAAGACAGG No data
Right 1152474520 17:80509285-80509307 GGTATTCCTGGGGGAGATCAAGG No data
1152474503_1152474513 2 Left 1152474503 17:80509238-80509260 CCACTTAAAATGGCCAAGACAGG No data
Right 1152474513 17:80509263-80509285 CTGCCTTTTCTGGGGGTTCTGGG No data
1152474503_1152474508 -8 Left 1152474503 17:80509238-80509260 CCACTTAAAATGGCCAAGACAGG No data
Right 1152474508 17:80509253-80509275 AAGACAGGGGCTGCCTTTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152474503 Original CRISPR CCTGTCTTGGCCATTTTAAG TGG (reversed) Intergenic