ID: 1152474508

View in Genome Browser
Species Human (GRCh38)
Location 17:80509253-80509275
Sequence AAGACAGGGGCTGCCTTTTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152474499_1152474508 18 Left 1152474499 17:80509212-80509234 CCTCGTCTCCCTCTCTACAGACT No data
Right 1152474508 17:80509253-80509275 AAGACAGGGGCTGCCTTTTCTGG No data
1152474503_1152474508 -8 Left 1152474503 17:80509238-80509260 CCACTTAAAATGGCCAAGACAGG No data
Right 1152474508 17:80509253-80509275 AAGACAGGGGCTGCCTTTTCTGG No data
1152474500_1152474508 10 Left 1152474500 17:80509220-80509242 CCCTCTCTACAGACTTCTCCACT No data
Right 1152474508 17:80509253-80509275 AAGACAGGGGCTGCCTTTTCTGG No data
1152474501_1152474508 9 Left 1152474501 17:80509221-80509243 CCTCTCTACAGACTTCTCCACTT No data
Right 1152474508 17:80509253-80509275 AAGACAGGGGCTGCCTTTTCTGG No data
1152474498_1152474508 22 Left 1152474498 17:80509208-80509230 CCAACCTCGTCTCCCTCTCTACA No data
Right 1152474508 17:80509253-80509275 AAGACAGGGGCTGCCTTTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152474508 Original CRISPR AAGACAGGGGCTGCCTTTTC TGG Intergenic
No off target data available for this crispr