ID: 1152475744

View in Genome Browser
Species Human (GRCh38)
Location 17:80516891-80516913
Sequence TCCAGCCAGTCCACAACTGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152475744_1152475752 12 Left 1152475744 17:80516891-80516913 CCGGCAGTTGTGGACTGGCTGGA No data
Right 1152475752 17:80516926-80516948 CGGGAAGGAAAGAGGGGCAGAGG No data
1152475744_1152475748 -3 Left 1152475744 17:80516891-80516913 CCGGCAGTTGTGGACTGGCTGGA No data
Right 1152475748 17:80516911-80516933 GGACGGTGCTGAGAGCGGGAAGG No data
1152475744_1152475746 -8 Left 1152475744 17:80516891-80516913 CCGGCAGTTGTGGACTGGCTGGA No data
Right 1152475746 17:80516906-80516928 TGGCTGGACGGTGCTGAGAGCGG No data
1152475744_1152475753 13 Left 1152475744 17:80516891-80516913 CCGGCAGTTGTGGACTGGCTGGA No data
Right 1152475753 17:80516927-80516949 GGGAAGGAAAGAGGGGCAGAGGG No data
1152475744_1152475754 26 Left 1152475744 17:80516891-80516913 CCGGCAGTTGTGGACTGGCTGGA No data
Right 1152475754 17:80516940-80516962 GGGCAGAGGGCATCTGAGCCTGG No data
1152475744_1152475751 6 Left 1152475744 17:80516891-80516913 CCGGCAGTTGTGGACTGGCTGGA No data
Right 1152475751 17:80516920-80516942 TGAGAGCGGGAAGGAAAGAGGGG No data
1152475744_1152475747 -7 Left 1152475744 17:80516891-80516913 CCGGCAGTTGTGGACTGGCTGGA No data
Right 1152475747 17:80516907-80516929 GGCTGGACGGTGCTGAGAGCGGG No data
1152475744_1152475749 4 Left 1152475744 17:80516891-80516913 CCGGCAGTTGTGGACTGGCTGGA No data
Right 1152475749 17:80516918-80516940 GCTGAGAGCGGGAAGGAAAGAGG No data
1152475744_1152475750 5 Left 1152475744 17:80516891-80516913 CCGGCAGTTGTGGACTGGCTGGA No data
Right 1152475750 17:80516919-80516941 CTGAGAGCGGGAAGGAAAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152475744 Original CRISPR TCCAGCCAGTCCACAACTGC CGG (reversed) Intergenic
No off target data available for this crispr