ID: 1152478194

View in Genome Browser
Species Human (GRCh38)
Location 17:80532239-80532261
Sequence ATGGCTGCCCAGAAATATAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152478194_1152478202 9 Left 1152478194 17:80532239-80532261 CCTTTATATTTCTGGGCAGCCAT No data
Right 1152478202 17:80532271-80532293 GATGTCATAGGGGTCCCTTTAGG No data
1152478194_1152478200 -1 Left 1152478194 17:80532239-80532261 CCTTTATATTTCTGGGCAGCCAT No data
Right 1152478200 17:80532261-80532283 TTCCTTTTGGGATGTCATAGGGG No data
1152478194_1152478198 -3 Left 1152478194 17:80532239-80532261 CCTTTATATTTCTGGGCAGCCAT No data
Right 1152478198 17:80532259-80532281 CATTCCTTTTGGGATGTCATAGG No data
1152478194_1152478199 -2 Left 1152478194 17:80532239-80532261 CCTTTATATTTCTGGGCAGCCAT No data
Right 1152478199 17:80532260-80532282 ATTCCTTTTGGGATGTCATAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152478194 Original CRISPR ATGGCTGCCCAGAAATATAA AGG (reversed) Intergenic
No off target data available for this crispr