ID: 1152478290

View in Genome Browser
Species Human (GRCh38)
Location 17:80532787-80532809
Sequence GGCTCTCTGCAGGGGGTAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152478283_1152478290 -2 Left 1152478283 17:80532766-80532788 CCACACTGCATACCAGGCGCTGG No data
Right 1152478290 17:80532787-80532809 GGCTCTCTGCAGGGGGTAAAAGG No data
1152478282_1152478290 -1 Left 1152478282 17:80532765-80532787 CCCACACTGCATACCAGGCGCTG No data
Right 1152478290 17:80532787-80532809 GGCTCTCTGCAGGGGGTAAAAGG No data
1152478280_1152478290 26 Left 1152478280 17:80532738-80532760 CCGTCTCAAACAAAACAATACTA No data
Right 1152478290 17:80532787-80532809 GGCTCTCTGCAGGGGGTAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152478290 Original CRISPR GGCTCTCTGCAGGGGGTAAA AGG Intergenic
No off target data available for this crispr