ID: 1152480980

View in Genome Browser
Species Human (GRCh38)
Location 17:80552389-80552411
Sequence TCTAGGTCCCTTCCTCAGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 223
Summary {0: 1, 1: 0, 2: 3, 3: 19, 4: 200}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152480978_1152480980 1 Left 1152480978 17:80552365-80552387 CCTTCTCGTCGTTCATACTTAGC 0: 1
1: 0
2: 0
3: 3
4: 34
Right 1152480980 17:80552389-80552411 TCTAGGTCCCTTCCTCAGAGAGG 0: 1
1: 0
2: 3
3: 19
4: 200
1152480975_1152480980 8 Left 1152480975 17:80552358-80552380 CCTGGCCCCTTCTCGTCGTTCAT 0: 1
1: 0
2: 0
3: 7
4: 108
Right 1152480980 17:80552389-80552411 TCTAGGTCCCTTCCTCAGAGAGG 0: 1
1: 0
2: 3
3: 19
4: 200
1152480977_1152480980 2 Left 1152480977 17:80552364-80552386 CCCTTCTCGTCGTTCATACTTAG 0: 1
1: 0
2: 0
3: 2
4: 44
Right 1152480980 17:80552389-80552411 TCTAGGTCCCTTCCTCAGAGAGG 0: 1
1: 0
2: 3
3: 19
4: 200
1152480976_1152480980 3 Left 1152480976 17:80552363-80552385 CCCCTTCTCGTCGTTCATACTTA 0: 1
1: 0
2: 0
3: 1
4: 52
Right 1152480980 17:80552389-80552411 TCTAGGTCCCTTCCTCAGAGAGG 0: 1
1: 0
2: 3
3: 19
4: 200

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152480980 Original CRISPR TCTAGGTCCCTTCCTCAGAG AGG Intronic
900149150 1:1170716-1170738 TCTTGGTCACCTGCTCAGAGAGG - Intergenic
900156216 1:1204333-1204355 GAGAGGACCCTTCCTCAGAGTGG + Intronic
900732679 1:4272499-4272521 TCTAGGTCCCGTCCCCAGGCAGG - Intergenic
902391628 1:16110499-16110521 TCAAAATCCCCTCCTCAGAGCGG - Intergenic
902552060 1:17225072-17225094 TCTAGGGCCCTGCTGCAGAGTGG + Intronic
902811843 1:18892478-18892500 TCAGGGTCACCTCCTCAGAGAGG - Intronic
903143155 1:21352170-21352192 CCAAGTTTCCTTCCTCAGAGAGG - Intergenic
904993416 1:34612495-34612517 TAAATGTCACTTCCTCAGAGAGG + Intergenic
907907860 1:58800643-58800665 TCTACATCCCCTCCTCAGAGAGG - Intergenic
907976447 1:59435633-59435655 TCAATGTCACCTCCTCAGAGTGG + Intronic
908165050 1:61449495-61449517 TAGATGTCCCTTCTTCAGAGGGG - Intronic
909498023 1:76301420-76301442 TCTAGGTTCCTGCCTAATAGTGG + Intronic
912390430 1:109298807-109298829 TCTGGGTCCCTTCCTCTGCATGG + Intronic
920135833 1:203768631-203768653 TCTATAGTCCTTCCTCAGAGAGG - Intronic
920255459 1:204651503-204651525 TGTCAGTCCCTTCCTCAAAGAGG - Intronic
922650722 1:227335762-227335784 TATAGTTCCCGTCATCAGAGTGG - Intergenic
923564909 1:235069513-235069535 CCTGCGTCCCTTCCTCAGAGAGG - Intergenic
924553214 1:245097741-245097763 TCAAGATCCCCTCCTTAGAGGGG - Intronic
1064856407 10:19773150-19773172 TCAAGTTCACTTCCTCTGAGAGG - Intronic
1065455616 10:25903707-25903729 TCAAGGTCAATTGCTCAGAGAGG + Intergenic
1065874281 10:29983613-29983635 TCTCTGACCCTTCCTCATAGTGG - Intergenic
1067065530 10:43102089-43102111 TAGAGGCCCCTTCCTCAGGGAGG - Intronic
1068546109 10:58347193-58347215 TCTAGATCCCTCCCTCTGAAAGG - Intronic
1073200011 10:101727652-101727674 TCTATGTCCGTTCCTCAGGAAGG - Intergenic
1074719343 10:116251011-116251033 TCAAAGTCACCTCCTCAGAGAGG + Intronic
1075145944 10:119883154-119883176 TCTATGTCCCTTCCCAAGGGAGG - Intronic
1077486948 11:2843338-2843360 TCTAGGTACCGCCCTGAGAGTGG + Intronic
1078437430 11:11337126-11337148 TCTGGGTCTCATCCTCAGAGAGG - Intronic
1080196128 11:29611591-29611613 ACTAGGTTCCTTCCCCAAAGGGG + Intergenic
1081742916 11:45453517-45453539 TCAATGTCTCTTTCTCAGAGAGG - Intergenic
1083328625 11:61886393-61886415 CCCAGGCCCCTTCCCCAGAGGGG - Intronic
1084090223 11:66874877-66874899 TCTGTGTCCCCTCCTCAGAGAGG - Intronic
1084565193 11:69924578-69924600 TGCATGTCACTTCCTCAGAGAGG + Intergenic
1084572528 11:69968233-69968255 TCTTGGTGCCTCCCTGAGAGAGG + Intergenic
1086202057 11:84215720-84215742 TCTACCTACTTTCCTCAGAGAGG - Intronic
1090839647 11:130476992-130477014 TCGTTGTCCCTTCCTCTGAGGGG - Intergenic
1090943477 11:131409397-131409419 TCTGGCTGCCTTCCACAGAGAGG + Intronic
1092090530 12:5800107-5800129 TCAATGTCACCTCCTCAGAGAGG - Intronic
1092129337 12:6097881-6097903 TCTATGTCCCTTCCTTAATGTGG - Intronic
1092285875 12:7129077-7129099 TCCAGGTTCCTTCCTCAGGAAGG - Intergenic
1095336881 12:41039195-41039217 TCTACTTCCCTTCCAAAGAGTGG - Intronic
1095422024 12:42034101-42034123 TATTGGTACCTACCTCAGAGGGG - Intergenic
1097038977 12:56143012-56143034 TGTAGGTCCCTTCGACAGAATGG + Exonic
1098562237 12:71887636-71887658 TTAATGTCACTTCCTCAGAGGGG + Intronic
1101630082 12:106484725-106484747 TCAATGTCGCTTCCTCCGAGAGG - Intronic
1102389262 12:112536424-112536446 TCAACGTCACCTCCTCAGAGAGG - Intergenic
1104554795 12:129789990-129790012 TCCAGTTCCCTTCCGCAAAGGGG - Intronic
1106188401 13:27428347-27428369 TCTCGGTCCCTTCCTCTGGCTGG + Intronic
1109538330 13:63742242-63742264 TCTCAGTCCCTGCCTCAGTGGGG + Intergenic
1109545509 13:63837530-63837552 TCTCAGTCCCTGCCTCAGTGGGG - Intergenic
1111168366 13:84492141-84492163 TCTAGTTCCCACCCACAGAGGGG + Intergenic
1112550863 13:100419109-100419131 TCAAGATCACCTCCTCAGAGAGG + Intronic
1112965876 13:105193123-105193145 TCCAGGGGCCTCCCTCAGAGTGG + Intergenic
1115814521 14:37148729-37148751 ACTTGGTCTCTTCCTTAGAGGGG + Intronic
1121343090 14:93116342-93116364 TCTAGGTCCCCTTCACTGAGGGG + Intergenic
1121473605 14:94174760-94174782 TCTCGGACCCTTCCTCAGAGCGG + Intronic
1121565882 14:94908753-94908775 CCTGGGTCCCTTCCTCACAAGGG + Intergenic
1124630232 15:31332248-31332270 AATAGGTCTCTCCCTCAGAGCGG - Intronic
1125554569 15:40573565-40573587 TACAGGTCACTTCCTCAGTGGGG - Exonic
1125712085 15:41795256-41795278 CAAAGGTCTCTTCCTCAGAGAGG - Intronic
1127575744 15:60290013-60290035 TCTAGATGCCTTCATCTGAGAGG + Intergenic
1128800670 15:70494875-70494897 CCTGGGTCCCTTCCTCCCAGGGG - Intergenic
1128824807 15:70703901-70703923 CCAATGTCACTTCCTCAGAGAGG + Intronic
1131036436 15:89225493-89225515 TCTTGGGCCCTTCCCCAGAGAGG + Intergenic
1132269877 15:100514265-100514287 TTTAGTTCCCTTCCTTAGAAGGG - Intronic
1132672719 16:1108302-1108324 CTGAGGCCCCTTCCTCAGAGTGG + Intergenic
1133236489 16:4389582-4389604 TCCAGGTCCCGTCCTTCGAGGGG + Intronic
1134686195 16:16160171-16160193 CCTAAGTCACCTCCTCAGAGAGG + Intronic
1137637479 16:49999443-49999465 TCAAGGTCACCTCCTCAGAATGG - Intergenic
1138267841 16:55672569-55672591 CCTATGTCACCTCCTCAGAGAGG - Intronic
1138370224 16:56520703-56520725 TGAAGGTCACTTTCTCAGAGAGG - Intergenic
1140479843 16:75256671-75256693 CGTAGGTGCCTGCCTCAGAGAGG + Intronic
1142678523 17:1531191-1531213 ACTGGGACCCTTCCTCAGTGTGG + Intronic
1143269913 17:5667894-5667916 CCCAGGTCCCTGCCCCAGAGAGG + Intergenic
1143524984 17:7466630-7466652 TTCAAGTCCCTTCTTCAGAGAGG - Exonic
1143736126 17:8913182-8913204 TAAATGTCCCTTCTTCAGAGAGG - Intronic
1143795107 17:9330004-9330026 TGCAGGCCCCTTGCTCAGAGGGG + Intronic
1144961104 17:19044650-19044672 TCCATGTCACTTCTTCAGAGAGG - Intronic
1144974057 17:19129874-19129896 TCCATGTCACTTCTTCAGAGAGG + Intronic
1145998465 17:29117708-29117730 TCTTGTTCCCTTCCTGACAGAGG - Intronic
1146508640 17:33426909-33426931 TATAAGTCGCTTCCTCAAAGAGG - Intronic
1148858577 17:50592354-50592376 GCTAGACCCCTTCCCCAGAGAGG + Intronic
1150245606 17:63672520-63672542 TATAGGTCTCTAGCTCAGAGGGG + Intronic
1151846131 17:76656996-76657018 ACCTGGTCACTTCCTCAGAGAGG - Intergenic
1152131993 17:78483160-78483182 TCCAGGCTCCCTCCTCAGAGTGG + Intronic
1152480980 17:80552389-80552411 TCTAGGTCCCTTCCTCAGAGAGG + Intronic
1153757920 18:8302218-8302240 TCCATGTCCCATCCTCAGGGAGG - Intronic
1155047270 18:22113872-22113894 TCTAGGTTACTTCCTGAGTGGGG - Intergenic
1155099818 18:22599550-22599572 TTTATGTTTCTTCCTCAGAGAGG + Intergenic
1157614093 18:48976537-48976559 CCTCGGTCCCTTCCCCAGGGAGG - Intergenic
1159469137 18:68826559-68826581 TCTAATTCCCTTCCTCTCAGTGG - Intronic
1161497070 19:4592481-4592503 TCAATGTCACCTCCTCAGAGAGG - Intergenic
1162024392 19:7885419-7885441 CACAGGTCCCTTCCTCAAAGCGG + Intergenic
1162362745 19:10229718-10229740 TAAAGGTCACTTCCTCAGAGGGG + Intronic
1163735980 19:18981071-18981093 TCTAGGTCTGTTGCTCAGACTGG + Intergenic
1164595999 19:29530925-29530947 TCTGGGTGCCTTCCTAACAGTGG - Intronic
1164794061 19:31012164-31012186 CCCAGGGCCCTTCCTCAGACAGG + Intergenic
1165639785 19:37374538-37374560 TAAATGTCACTTCCTCAGAGAGG - Intronic
1167597595 19:50435692-50435714 TCTAAGTCCTTTCCCCAAAGCGG + Intronic
926139476 2:10359737-10359759 GTAAGGCCCCTTCCTCAGAGTGG - Intronic
926346871 2:11955009-11955031 TCTATAACCCTTCCTCAGAGGGG + Intergenic
930461448 2:51683186-51683208 TTTAGGTCTCATTCTCAGAGGGG + Intergenic
930472986 2:51844442-51844464 TCCAGGACCCTTCCTTAGACCGG - Intergenic
930813576 2:55568844-55568866 TAAAGCTCCCTCCCTCAGAGAGG - Intronic
931046612 2:58361349-58361371 TCTATGTCCCATTCTCATAGTGG + Intergenic
931047281 2:58369384-58369406 TATAAGTAACTTCCTCAGAGAGG + Intergenic
931750330 2:65324575-65324597 TCAAGGTCCCTCCATAAGAGAGG - Intronic
931975530 2:67639939-67639961 CCTAGGTCACTTCCTCAGCCTGG + Intergenic
932263476 2:70346202-70346224 TCTTGCTCTCTTGCTCAGAGTGG + Intergenic
932598008 2:73106337-73106359 TGTATGTCCCCTCCTCACAGAGG + Intronic
933675348 2:85051303-85051325 TCTAAGTCCCTACCTCAAAAAGG + Intronic
933771570 2:85747987-85748009 TCTATGTCCCCTTCTCAGTGAGG - Intergenic
940216398 2:151307907-151307929 TCAATGTCACCTCCTCAGAGAGG + Intergenic
940419635 2:153464571-153464593 TTTATGTCCTGTCCTCAGAGTGG - Intergenic
941253526 2:163198339-163198361 TCTAGGCCCTCTCCTCAGATGGG + Intergenic
941857912 2:170249138-170249160 GCTACCTCCCTTCCTCTGAGTGG - Intronic
942721663 2:178959814-178959836 TCTATGCCACTTCCTCGGAGAGG + Intronic
948942428 2:241203135-241203157 CATATGTCCCCTCCTCAGAGAGG + Intronic
1169112851 20:3044669-3044691 TCCAGGGCCCTTCCTTAGAAGGG - Exonic
1171060680 20:21956587-21956609 TCTAGGCAGCTTTCTCAGAGTGG + Intergenic
1172944307 20:38675479-38675501 TCAGCGTCCCTTCCTCTGAGAGG + Intergenic
1173945366 20:46946059-46946081 TCTGGGTCCCTTTCCCAGTGGGG + Intronic
1174716306 20:52762441-52762463 TCAATGTCCCATCCTCAGTGAGG - Intergenic
1175125997 20:56751936-56751958 TCTATGTCGCCTCCTCAGAGAGG - Intergenic
1175239824 20:57538800-57538822 CCTAAGGGCCTTCCTCAGAGTGG - Intergenic
1175541418 20:59750499-59750521 TCAAGGTCCCTTCCACCGCGGGG - Intronic
1175772225 20:61631007-61631029 TCAATGTCACCTCCTCAGAGAGG - Intronic
1178452203 21:32712810-32712832 TAAAGGTCACTTCCTCAGTGAGG - Intronic
1181363829 22:22358400-22358422 TCCAGGGCCCTGCCTGAGAGTGG + Intergenic
1181366635 22:22381485-22381507 TCCAGGGCCCTGCCTGAGAGTGG + Intergenic
1181373001 22:22432603-22432625 TCCAGGGCCCTGCCTGAGAGTGG + Intergenic
1181405279 22:22680074-22680096 TAAAAGTCCCTTCCTCAGAAAGG + Intergenic
1181772924 22:25139760-25139782 TCTATGTTCCCTCCTCAAAGAGG - Intronic
1181910071 22:26231582-26231604 TCTAGGGCCATTACTCAGTGTGG - Intronic
1181979688 22:26757145-26757167 ACGAGGTTCCTTCCGCAGAGGGG - Intergenic
1183830904 22:40417966-40417988 TCAGGGTCCTCTCCTCAGAGAGG - Intronic
1184270076 22:43375459-43375481 TCTAGGTCCCTGCCAGGGAGTGG + Intergenic
949289213 3:2444359-2444381 TCTGCATCCCTTCCTCAGAGAGG - Intronic
951500352 3:23379755-23379777 TAAAGGTCACCTCCTCAGAGAGG - Intronic
952161060 3:30693575-30693597 TCTAGGCACCCTCCTCAGTGTGG + Exonic
952927807 3:38334580-38334602 TCATTGTCCCTTCCTCAGATGGG - Intergenic
952997499 3:38899162-38899184 TCTAGTTCCCCTTCTCAGATTGG + Intronic
953783998 3:45896874-45896896 TCTCTGTCCATTCCCCAGAGAGG + Intronic
954408313 3:50357842-50357864 TCCCTGTCCCTTCCTCACAGGGG + Intronic
956189035 3:66590823-66590845 GCTATGTCACTTCCTCAGAGAGG + Intergenic
961583717 3:127904462-127904484 TTCAGGTCACCTCCTCAGAGAGG + Intergenic
968591843 4:1463473-1463495 TCCAAGTCACTTCCTCAAAGTGG + Intergenic
970569138 4:17362556-17362578 CCCAGCTCCCTTCCTGAGAGCGG + Intergenic
970852869 4:20622757-20622779 TAAATGTCACTTCCTCAGAGAGG - Intergenic
971395358 4:26222038-26222060 TCTAGGGCCCCTCGTCAAAGTGG - Intronic
973019613 4:45186347-45186369 TATAGGTCACTTCCTAAAAGTGG - Intergenic
976794270 4:88914582-88914604 CCCATGTCACTTCCTCAGAGAGG + Intronic
979435412 4:120683023-120683045 TCTTGGTTCCGTCCTTAGAGAGG + Intergenic
979677991 4:123430383-123430405 TCTAGGTCTCTTCCAGGGAGGGG + Intergenic
981910951 4:149981317-149981339 TCTTTGTCCCTTCCCCAGAGAGG - Intergenic
984925878 4:184806207-184806229 TGTACATCCCTTCCTCAGAAAGG - Intronic
985183741 4:187294273-187294295 CTTAGGTTCCTTCCACAGAGAGG + Intergenic
990409513 5:55527179-55527201 TCTGGGTCCCTTCCTCAAAGGGG - Intronic
993272044 5:85809048-85809070 TCTAAGTCCCTTTGACAGAGGGG - Intergenic
993716392 5:91279446-91279468 TCTAGGCCCCGACCTCAGACAGG + Intergenic
994184529 5:96803591-96803613 TCCAGCTCCCTTCCTGAGGGTGG + Exonic
996715894 5:126587827-126587849 TCTAAGTCCCTGCCCCAGGGAGG + Intronic
997420909 5:133766032-133766054 TATGGGTCCCCTCCTCAGTGTGG - Intergenic
998506099 5:142674105-142674127 TCTATGTCACCTGCTCAGAGAGG + Intronic
998538913 5:142960936-142960958 TATAGGTCACCTTCTCAGAGAGG + Intronic
998785975 5:145709257-145709279 TATGGGTCCCTTCCTAAGAGAGG - Intronic
999330563 5:150671297-150671319 TGAAGATCTCTTCCTCAGAGGGG - Intronic
999951259 5:156653535-156653557 TCTAGGTCCCTGACTCAGTCCGG - Intronic
1000365257 5:160484783-160484805 TCAATGTCACTTCCTCAGAGAGG - Intergenic
1001189253 5:169612106-169612128 TCTTGGTCCAGTTCTCAGAGGGG + Intergenic
1001286074 5:170425029-170425051 TCCAAGTCACTTCCTCAGAAAGG + Intronic
1003338985 6:5201693-5201715 TGTGGGTGCCTTCCCCAGAGAGG + Intronic
1003712308 6:8605527-8605549 GCTAGCTCCCATCCACAGAGAGG + Intergenic
1004025063 6:11810289-11810311 CCTGGGTCCCTTCCTCAGAGGGG + Intergenic
1005085400 6:22001265-22001287 TCTAGGGACCTTCCAGAGAGTGG + Intergenic
1005926010 6:30446247-30446269 CATAGTTCCCTTCTTCAGAGAGG + Intergenic
1006629753 6:35422550-35422572 TCTAGGGGTCTTACTCAGAGAGG - Intronic
1006812309 6:36827753-36827775 TCTCGGGCCCTTCGTCAGGGCGG - Intronic
1007849811 6:44792252-44792274 TCAAAGTCACCTCCTCAGAGAGG - Intergenic
1007932921 6:45708667-45708689 TAAATGTCCCTTCCTCAGAGAGG - Intergenic
1009628362 6:66164882-66164904 CCTGGATCCCTTCCCCAGAGGGG + Intergenic
1010593538 6:77737595-77737617 TAAATGTCCCTTCCTCAGAAAGG - Intronic
1011721167 6:90158023-90158045 TCCATATCCCTTCATCAGAGAGG - Intronic
1012001400 6:93659520-93659542 TCTAGGGTCTTTCCTCAAAGAGG - Intergenic
1012472652 6:99589091-99589113 TCTACGACCCATCCGCAGAGCGG - Intergenic
1014189795 6:118482096-118482118 TCTAGGTGCCTTTCACACAGAGG - Intronic
1017256556 6:152340161-152340183 TTCAGGTCGTTTCCTCAGAGGGG - Intronic
1020156400 7:5728188-5728210 TAAATGTCCCTTCCTCAGGGTGG + Intronic
1021177629 7:17468388-17468410 TATATGTCTCCTCCTCAGAGAGG + Intergenic
1023986538 7:45100409-45100431 TCTAGGTCCCATTCTATGAGTGG - Exonic
1024198356 7:47082001-47082023 TCTTGCTGCCTTCCTCAGAAGGG - Intergenic
1027184228 7:75960756-75960778 TCTGGGTCCCTACCTTAGTGCGG + Intronic
1027190915 7:75994946-75994968 TCTAACTCCCTTCCCCAAAGAGG - Intergenic
1028412034 7:90540290-90540312 TCCAGGTGCCTACCACAGAGAGG - Intronic
1032009679 7:128336563-128336585 TCTAAGCCCCTTCCTGGGAGTGG - Intronic
1032745821 7:134784905-134784927 TCCAGGTCCAGTCCTGAGAGAGG + Intronic
1034280416 7:149850156-149850178 TCCAGGACCCTTCTGCAGAGGGG + Exonic
1034552872 7:151832522-151832544 CCTAGGCTCCTTCCTCTGAGGGG - Intronic
1038248921 8:25884454-25884476 TCCATGTCCCCTCTTCAGAGAGG + Intronic
1038401700 8:27288905-27288927 ACTTGGTCCCTTCTTCAGAGAGG - Intronic
1038503266 8:28062998-28063020 TCTAAGTCCCATTCTCATAGCGG - Intronic
1038533407 8:28336930-28336952 TCTCGGTCCCTGTCTCTGAGTGG - Intronic
1039491327 8:37949669-37949691 TCTTGGTGCCTTCCTCACAGTGG + Intergenic
1039945822 8:42128384-42128406 TCAAGGCCCCTTCCTCCTAGGGG + Intergenic
1044562576 8:93627476-93627498 TCCATGTCCCTTCCTCAAAGAGG + Intergenic
1044634125 8:94305535-94305557 TCTTTGTCCATTTCTCAGAGTGG - Intergenic
1044867524 8:96586810-96586832 TCAACATCCCTTCCACAGAGTGG - Intronic
1046744538 8:117862805-117862827 TCAATGTCACTTCTTCAGAGAGG - Intronic
1047484083 8:125312865-125312887 CAAAGGTCACTTCCTCAGAGAGG - Intronic
1050528609 9:6567565-6567587 GCTCTGTCACTTCCTCAGAGAGG + Intronic
1053177781 9:35941291-35941313 TCTAGGTCATTTCCTCTTAGTGG + Intergenic
1056420082 9:86415893-86415915 CCCATGTCCCCTCCTCAGAGAGG - Intergenic
1058908374 9:109498929-109498951 CATAGGTCCCCTCCTCAGAGAGG + Intergenic
1187362382 X:18640833-18640855 TCCAGGCCCCTTCCTGGGAGAGG - Exonic
1195761550 X:108251434-108251456 TAAATGTCTCTTCCTCAGAGAGG + Intronic
1195815235 X:108877993-108878015 TTTACCTCCCTTCTTCAGAGTGG - Intergenic
1198008114 X:132519652-132519674 TGAATGTCACTTCCTCAGAGAGG + Intergenic
1198542251 X:137652364-137652386 TCAATGTCTCTTCCTCAGAGAGG - Intergenic
1198575367 X:138004752-138004774 TCGAGGTCAATTCCTCAGTGAGG - Intergenic
1199494711 X:148440223-148440245 TCAATGTCCTGTCCTCAGAGAGG + Intergenic
1202247620 Y:22835919-22835941 TCCAGGGCCATTCCTCAAAGAGG + Intergenic
1202400608 Y:24469667-24469689 TCCAGGGCCATTCCTCAAAGAGG + Intergenic
1202470172 Y:25200419-25200441 TCCAGGGCCATTCCTCAAAGAGG - Intergenic