ID: 1152484792

View in Genome Browser
Species Human (GRCh38)
Location 17:80583524-80583546
Sequence GGGACCTTGTGAGCTGGTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 330
Summary {0: 1, 1: 0, 2: 4, 3: 34, 4: 291}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152484784_1152484792 2 Left 1152484784 17:80583499-80583521 CCTCTTTCTGAGGCCTGTCCCAC 0: 1
1: 0
2: 1
3: 23
4: 219
Right 1152484792 17:80583524-80583546 GGGACCTTGTGAGCTGGTGGAGG 0: 1
1: 0
2: 4
3: 34
4: 291
1152484782_1152484792 16 Left 1152484782 17:80583485-80583507 CCAGCTGTTCACTGCCTCTTTCT 0: 1
1: 0
2: 3
3: 40
4: 436
Right 1152484792 17:80583524-80583546 GGGACCTTGTGAGCTGGTGGAGG 0: 1
1: 0
2: 4
3: 34
4: 291
1152484780_1152484792 25 Left 1152484780 17:80583476-80583498 CCACTGCGCCCAGCTGTTCACTG 0: 1
1: 0
2: 10
3: 142
4: 984
Right 1152484792 17:80583524-80583546 GGGACCTTGTGAGCTGGTGGAGG 0: 1
1: 0
2: 4
3: 34
4: 291
1152484781_1152484792 17 Left 1152484781 17:80583484-80583506 CCCAGCTGTTCACTGCCTCTTTC 0: 1
1: 0
2: 10
3: 81
4: 402
Right 1152484792 17:80583524-80583546 GGGACCTTGTGAGCTGGTGGAGG 0: 1
1: 0
2: 4
3: 34
4: 291

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152484792 Original CRISPR GGGACCTTGTGAGCTGGTGG AGG Intronic
900189745 1:1348394-1348416 GGGTCCTTGTGACAGGGTGGAGG - Intronic
900692972 1:3992802-3992824 GGGACCTGGGGTGGTGGTGGGGG + Intergenic
900976915 1:6023410-6023432 GGGACCCTGTGCACTGTTGGTGG - Intronic
901005931 1:6171511-6171533 GGGAGCGTGTGAGGTGTTGGGGG - Intronic
901020216 1:6251567-6251589 GGGAGCTTGTGTGATGGTGGGGG - Intronic
901220368 1:7580282-7580304 TGGACCGTGGGAGCTGTTGGGGG + Intronic
901526624 1:9826957-9826979 GTGACTTTGTTAGCTAGTGGAGG + Intergenic
901871460 1:12141227-12141249 GGGAACTTGAGAGCTGGGGTGGG - Intronic
902376201 1:16031053-16031075 GGGACTTTGGGAGCAGGAGGTGG + Intronic
902381129 1:16052779-16052801 GGGACTTTGGGAGCAGGAGGTGG + Intronic
902891515 1:19447707-19447729 AGCACCCTGGGAGCTGGTGGAGG + Intronic
903210021 1:21812635-21812657 GAGACCTTTTGAGCTGGGGGAGG + Intronic
903226900 1:21898921-21898943 GGGAGCTGGTCAGCGGGTGGCGG + Intronic
904323923 1:29714949-29714971 GGAACCTTGTGCACTGTTGGTGG - Intergenic
904439749 1:30522482-30522504 TGGAGCTTGTGTTCTGGTGGGGG - Intergenic
910109514 1:83667668-83667690 GTGACCTGTGGAGCTGGTGGAGG - Intergenic
911769562 1:101723112-101723134 GTGACCTTGGAAGATGGTGGTGG + Intergenic
915063528 1:153206033-153206055 GGGACATAGTGAGTTGGTGAAGG + Intergenic
915973548 1:160370656-160370678 GGGAGCTTGAAAGCTGGTGGTGG - Exonic
919757917 1:201077499-201077521 GGGCCTTTGTGAGGTGGTGAGGG - Intronic
919815018 1:201431725-201431747 GGGGCCTTGGGAGCTGGGGGTGG + Intergenic
919916447 1:202142626-202142648 GGGACCTTGTGGGCTGGAGATGG + Intronic
922722332 1:227905356-227905378 GGGACCTTGTGGCCTGGGGTGGG - Intergenic
922757962 1:228106957-228106979 GGGACCTTGAGAGCTACTGGGGG + Intronic
924801180 1:247330776-247330798 CCCACCTTGTGAGCTGTTGGAGG - Intronic
924933838 1:248751479-248751501 GGGACATTGTGCTCTGGGGGAGG - Intronic
1062877645 10:955205-955227 GGGGGCTTCTGAGGTGGTGGAGG + Intergenic
1064276617 10:13912255-13912277 GGGCCCTTGTGCACTGCTGGTGG + Intronic
1065687675 10:28302671-28302693 GGCACCTTGTGAGGAGGTGGGGG - Intronic
1066000269 10:31098330-31098352 CGTCCCTTGTGAGCTGGTGAAGG + Intergenic
1067686867 10:48470998-48471020 GCAACCTTGTTAGCTGGTAGTGG - Intronic
1067945540 10:50686077-50686099 AGGGCCTTGTGAGTGGGTGGTGG - Intergenic
1069720260 10:70545163-70545185 GGGACCTTGCAGGGTGGTGGGGG + Intronic
1070535941 10:77377280-77377302 GAGGCCTTGTCAGCAGGTGGGGG - Intronic
1071492629 10:86146424-86146446 GTGACATTAGGAGCTGGTGGTGG - Intronic
1071633965 10:87235173-87235195 AGGGCCTTGTGAGTGGGTGGTGG - Intronic
1071647413 10:87367390-87367412 AGGGCCTTGTGAGTGGGTGGTGG - Intronic
1074387793 10:113030794-113030816 AGGGACTTGTGTGCTGGTGGTGG + Intronic
1074390087 10:113049854-113049876 TGGAGCTTTTGTGCTGGTGGAGG + Intronic
1074748226 10:116557391-116557413 GGGGCCAGGTGATCTGGTGGTGG + Intronic
1075095526 10:119468518-119468540 GTGAACTTGGGAGCTGGGGGTGG - Intergenic
1075428768 10:122363568-122363590 GGGAGGTTGTGAGATGCTGGAGG + Intergenic
1076619773 10:131779768-131779790 GAGGCCTTGGAAGCTGGTGGGGG - Intergenic
1077432391 11:2522256-2522278 GGGACCACATGAGCTGGGGGGGG + Intronic
1077440214 11:2565236-2565258 GGGACCTTGTGTGCTGCTGGGGG - Intronic
1082045526 11:47723013-47723035 GGCATTTTGGGAGCTGGTGGTGG + Exonic
1083112499 11:60425073-60425095 AGTACCTTGTGAACTGATGGAGG - Intergenic
1083234356 11:61342281-61342303 GGGAGCTTGTGGCCTGGTGGTGG - Intronic
1084610856 11:70202240-70202262 GGGTCCTTGTTGGCTGGTGAGGG + Intergenic
1084840696 11:71843944-71843966 TGGCCCTTGTGGGCTGGTGCAGG - Intergenic
1088530163 11:110799684-110799706 GGGACCTTGGGAGCTTGTGTGGG + Intergenic
1088747247 11:112814476-112814498 GGGGTCTGGTGAGCTGGTAGTGG - Intergenic
1089460728 11:118651857-118651879 TGCACATTGTGAGTTGGTGGGGG + Intronic
1089620978 11:119721968-119721990 GGAGGCGTGTGAGCTGGTGGTGG + Intronic
1089663770 11:120003472-120003494 GGGAGGATGGGAGCTGGTGGGGG + Intergenic
1090306247 11:125693574-125693596 GGGACCAGGTGAGCAGGTGATGG + Intergenic
1091330050 11:134725176-134725198 GGGGCCATGAGAGCTGGAGGAGG + Intergenic
1092018426 12:5179594-5179616 AGGACATTGTGAGCTGGGAGCGG - Intergenic
1096550497 12:52368888-52368910 GAGACCTTGGCAGCTGGTGGGGG + Intergenic
1097031798 12:56095094-56095116 GAGAGCTAGTGAGCTGGAGGTGG + Intronic
1097692763 12:62748699-62748721 TGAACCTTCTGAGCTGGAGGAGG - Intronic
1097713037 12:62935294-62935316 GGGGCGCTGTGAGCTGGAGGCGG + Intergenic
1101526228 12:105533694-105533716 TGGAACTTATGAGCTAGTGGAGG - Intergenic
1102027079 12:109719730-109719752 GGGAGCTTATAAGATGGTGGAGG + Intronic
1102457380 12:113079087-113079109 GGGACCCAGTGAGCTGCTGTTGG + Intronic
1103987509 12:124777798-124777820 GGGACCCTGTGAGGGGGTGGGGG + Exonic
1104754103 12:131258306-131258328 GTGACCTGGGGAGCTGGTGGGGG + Intergenic
1105243604 13:18628659-18628681 GGAGCCTGGTGAGATGGTGGAGG + Intergenic
1105279397 13:18954436-18954458 GGGCTCTTGTGAGCTGGTGCTGG - Intergenic
1105434457 13:20364614-20364636 GGGACCTTGAGAGTTGGGGAGGG + Intergenic
1112526532 13:100153239-100153261 GTAACCTTATGATCTGGTGGAGG + Intronic
1113670356 13:112171663-112171685 GGGATGGGGTGAGCTGGTGGGGG + Intergenic
1113806652 13:113113994-113114016 GGGCCCTGGGGAGCTGGTGGAGG + Intronic
1114870407 14:26648859-26648881 GAGACCTACTGAGCTGATGGTGG + Intergenic
1115475047 14:33805434-33805456 GCAGCCTTGTGAGCTGGAGGTGG + Intergenic
1116400797 14:44504952-44504974 GGGGCCTCCTCAGCTGGTGGAGG + Exonic
1116400806 14:44504988-44505010 GGGGCCTCCTCAGCTGGTGGAGG + Exonic
1116400815 14:44505024-44505046 GGGGCCTCCTCAGCTGGTGGAGG + Exonic
1116400824 14:44505060-44505082 GGGGCCTCCTCAGCTGGTGGAGG + Exonic
1116400833 14:44505096-44505118 GGGGCCTCCTCAGCTGGTGGAGG + Exonic
1116400842 14:44505132-44505154 GGGGCCTCCTCAGCTGGTGGAGG + Exonic
1118663307 14:68038726-68038748 TAGATCTTGGGAGCTGGTGGGGG - Intronic
1121715729 14:96072384-96072406 GGGCCCCTGGGAGGTGGTGGTGG - Intronic
1122243547 14:100384576-100384598 GGGACCTGGTGATCTGGGGAAGG + Intronic
1122388254 14:101363294-101363316 GGAACCTTGTGTGCTGTTGGTGG - Intergenic
1122416979 14:101554755-101554777 AGGACCTTCTGAGCAGGTGGGGG - Intergenic
1122771738 14:104100757-104100779 GGTGGCTTGTGAGCTGGTGCTGG + Intronic
1123438417 15:20272586-20272608 GGCATCTTCTGTGCTGGTGGTGG - Intergenic
1123487697 15:20755973-20755995 GGAGCCTGGTGAGATGGTGGAGG - Intergenic
1123544189 15:21325031-21325053 GGAGCCTGGTGAGATGGTGGAGG - Intergenic
1124653328 15:31488393-31488415 AGGAGCTTCTGAGCTGCTGGGGG + Intronic
1125382386 15:39100651-39100673 GGGATCCTGCGACCTGGTGGAGG + Intergenic
1125524355 15:40365718-40365740 AGGACCAGGTGAGCTGGTGGGGG + Exonic
1127069624 15:55275976-55275998 GGAACCTTGTACGCTGTTGGTGG + Intronic
1127328322 15:57916387-57916409 GGGACCTGGGGTGGTGGTGGGGG + Intergenic
1128248268 15:66147718-66147740 GGTGCCTTCTGAGCTGGAGGGGG + Intronic
1128338041 15:66800916-66800938 GGGTCCTTGTGAGGGGATGGGGG + Intergenic
1131048033 15:89328583-89328605 CTGACCCTGAGAGCTGGTGGTGG - Intronic
1131434165 15:92409942-92409964 TGGAGTTTGTGATCTGGTGGGGG + Intronic
1131750494 15:95502220-95502242 GGGAAATTATGAGATGGTGGTGG + Intergenic
1131872039 15:96773334-96773356 GGGACCTTGTGCCCTGGAGGTGG + Intergenic
1132302829 15:100787132-100787154 GGGGCCATGTGAGCTGGAGCAGG - Intergenic
1202952532 15_KI270727v1_random:52302-52324 GGAGCCTGGTGAGATGGTGGAGG - Intergenic
1132525534 16:412302-412324 CGGACCTTGTGGGCAGCTGGAGG - Exonic
1132731249 16:1363080-1363102 GGGAGTTTGTGACCTTGTGGTGG + Exonic
1133538136 16:6721863-6721885 GGGATAATGTGGGCTGGTGGGGG - Intronic
1135520415 16:23172692-23172714 GCTGCCTTGTGAGCTGGAGGGGG - Intergenic
1136030578 16:27499815-27499837 GGGGCCATGTGAGCTGGAGCTGG - Intronic
1136278108 16:29191513-29191535 GGGGCCTTGGGAGGGGGTGGCGG - Intergenic
1138844898 16:60553956-60553978 ATGCCCTTGTGAGCTGGTTGTGG - Intergenic
1139690688 16:68640129-68640151 GGATCCTTGTGTGCTGTTGGTGG - Intronic
1139960550 16:70715077-70715099 GGTACCCTGTGAGCCAGTGGAGG - Intronic
1140114517 16:72029993-72030015 GGGACCTGGTGGTCTGCTGGTGG + Intergenic
1141767464 16:86067983-86068005 GGGACTTTGGGAGCTGCTGCAGG + Intergenic
1141942077 16:87283798-87283820 GGGGTCTTGTGCCCTGGTGGTGG - Intronic
1141949508 16:87331527-87331549 GGGAAACTGTGAGCTGGGGGAGG + Intronic
1142082484 16:88157553-88157575 GGGGCCTTGGGAGGGGGTGGCGG - Intergenic
1143118810 17:4595082-4595104 GGGGCCTGGTGAGCTAGTGATGG + Intronic
1143131706 17:4682635-4682657 GGGCCCTTGTGGGGTGCTGGGGG - Intronic
1143324303 17:6088363-6088385 GGGAGCTTGGGTGCTGGTGCTGG + Intronic
1144424701 17:15131048-15131070 AGAACCCTGTGAGCTGCTGGGGG - Intergenic
1144733008 17:17539685-17539707 GTGACCTTGTGAGCTGATTCAGG - Intronic
1144790528 17:17856104-17856126 GTGGCCTTGGCAGCTGGTGGTGG - Intronic
1146630560 17:34466448-34466470 CGGCCCTTGTGAGCTGGTAGGGG - Intergenic
1146772154 17:35578721-35578743 GGGCCCTTGTGGGCTGGTTTTGG + Intronic
1146919865 17:36703317-36703339 GGGGCCTTCTGATCTGGTTGGGG + Intergenic
1147375476 17:40020181-40020203 GAGACCTTGTCAGCTGGAAGGGG - Intronic
1147603029 17:41757619-41757641 GGGCACTGGTGAGCTGGGGGAGG - Exonic
1148238061 17:45982655-45982677 GCCACCTAGCGAGCTGGTGGCGG + Intronic
1148701221 17:49588157-49588179 GGGACCATGTGAGCAGGTGGGGG - Intergenic
1149896573 17:60433054-60433076 GGCACATGGTGAGCTGTTGGTGG + Intergenic
1152228958 17:79105249-79105271 GGGACCCAGGGAGCTGATGGGGG + Intronic
1152484792 17:80583524-80583546 GGGACCTTGTGAGCTGGTGGAGG + Intronic
1152486798 17:80599791-80599813 GGCCCCTTGTTAGGTGGTGGTGG + Intronic
1152805556 17:82354180-82354202 GGGACCAAGTGAGGGGGTGGAGG - Intergenic
1152878967 17:82804586-82804608 GGTGCCTTGTGGGCTGTTGGTGG + Intronic
1153939967 18:9968953-9968975 GGGAGCTTGCGTTCTGGTGGAGG - Intergenic
1154445340 18:14431226-14431248 GGAGCCTGGTGAGATGGTGGAGG - Intergenic
1157555615 18:48611124-48611146 GGGACCTTGGGGGCTGAAGGGGG - Intronic
1158113802 18:53972266-53972288 GGGACCTTGGGAGCTGTAGAAGG - Intergenic
1158138348 18:54230047-54230069 AGTGCCTTGTGGGCTGGTGGGGG - Intergenic
1158351799 18:56571900-56571922 TGGCCCTGGTGAGCTTGTGGTGG + Intergenic
1158438922 18:57456115-57456137 GGAACCTTGTGTGCTGTTGGTGG + Intronic
1158439015 18:57457146-57457168 GGAACCTTGTGTGCTGTTGGTGG - Intronic
1160406895 18:78652546-78652568 GGGAGCTCGTGTGCTGGTGAAGG + Intergenic
1160707344 19:535768-535790 GGCACCTTGTGAGCTGGGGCAGG + Intronic
1161142460 19:2656091-2656113 GGAACCCTGTGTGCTGTTGGTGG + Intronic
1161714203 19:5866347-5866369 GGGACCTTGCCAGCTGGGGCTGG - Exonic
1161971296 19:7582369-7582391 GGGATCTTGTGTATTGGTGGAGG + Intergenic
1162285235 19:9733775-9733797 GGGAACTTGTAAACTAGTGGAGG - Intergenic
1163721666 19:18900807-18900829 GGCTCCTTGGGAGCTGGTGCAGG - Intronic
1163764315 19:19154058-19154080 TGGGCCTTCTGAGCTGGAGGAGG + Intronic
1165225647 19:34352866-34352888 GCTGCCTTGTGTGCTGGTGGGGG - Exonic
1165431673 19:35776452-35776474 GGAACCTTATGGGCTGGAGGGGG + Intronic
1166654152 19:44597993-44598015 GAAACCTTGTGTGCTGTTGGTGG + Intergenic
1166995130 19:46716454-46716476 GGGATCTCGTGAGCAGGTGGTGG + Exonic
1168291383 19:55359339-55359361 GGGGCCTTCTGAGATGGGGGTGG + Exonic
925831761 2:7903238-7903260 GGGACCCTGTGAGTAGATGGAGG - Intergenic
926212436 2:10880682-10880704 GGGAGCCTGTGAGGTGGTGCGGG - Intergenic
926335017 2:11856654-11856676 GGGAACTTGTGTGTTGCTGGAGG + Intergenic
926934585 2:18074191-18074213 GGGCCCTTGTGAGCGGATGCAGG - Intronic
927103952 2:19808413-19808435 GGGAGCTTGTGAGAGAGTGGCGG - Intergenic
927397461 2:22670249-22670271 GGGACCTTGAGAGCCTGAGGAGG + Intergenic
927974275 2:27326450-27326472 GGAGCCTTGAGAGTTGGTGGAGG + Exonic
928154491 2:28864231-28864253 AGGACGTTGTCAGCTGTTGGGGG - Intronic
928315197 2:30239342-30239364 ATGGCCTCGTGAGCTGGTGGGGG - Intronic
931319384 2:61161022-61161044 GGAACCTTGTGCACTGTTGGTGG - Intronic
931356164 2:61538792-61538814 CGCAGCTCGTGAGCTGGTGGCGG + Intergenic
931810255 2:65847909-65847931 CTGAGCTTGTGAGATGGTGGTGG + Intergenic
932147229 2:69332974-69332996 AGGACCATGTGAGCAGCTGGAGG - Intronic
932331510 2:70900715-70900737 GGGGACTTGCGAGCTGATGGCGG + Exonic
934730294 2:96652206-96652228 AGGAGCTGGTGGGCTGGTGGGGG + Intergenic
936029930 2:109062843-109062865 GGGGCCCTGGGAGCGGGTGGAGG + Intergenic
937042700 2:118834316-118834338 GGGACCCTGGGTGTTGGTGGAGG - Intergenic
937858010 2:126686669-126686691 GGGACCTTGCAACCTGGAGGAGG + Intronic
942560823 2:177216714-177216736 GGGAACTTTGGAGGTGGTGGAGG + Exonic
944412089 2:199456092-199456114 GGGACCTAGGGAGGGGGTGGGGG + Exonic
946148374 2:217747916-217747938 GTGACCTGGTGAGCTGCAGGTGG - Intronic
946179139 2:217939650-217939672 GGGGCCTGGGGAGCTGATGGGGG - Intronic
947639201 2:231696866-231696888 AGGACCCTGTGAGCTGGGCGTGG - Intergenic
947888321 2:233594036-233594058 GGGACCGTGATAGCTGGTGGGGG - Intergenic
947894541 2:233657159-233657181 GGGACCTTGATAGCTAGTGGGGG - Intronic
948505021 2:238422655-238422677 GGGCGCTTGGGAGCTGGAGGAGG + Intergenic
948716927 2:239871139-239871161 GGGACCTCGTGGGCTGGGGACGG + Intergenic
948860082 2:240748566-240748588 AGGACCTGGTGAGGTGGGGGTGG + Intronic
1169842538 20:9955766-9955788 GTGAAGTTGTGAGGTGGTGGGGG - Intergenic
1169940229 20:10928930-10928952 GGTAACTTGGGAGGTGGTGGAGG - Intergenic
1170633279 20:18083345-18083367 AGGACCTTGTGGGCTGGGGCAGG - Intergenic
1173765335 20:45602652-45602674 GGAACCTTGTGCACTGTTGGTGG - Intergenic
1174214835 20:48908389-48908411 GGGACGTAGTTGGCTGGTGGTGG - Intergenic
1174334919 20:49853149-49853171 GGGAACTTGGGAGCCTGTGGTGG + Intronic
1174736518 20:52971098-52971120 GGCACCTTTTGAGGTGTTGGGGG - Intergenic
1175665018 20:60851311-60851333 GGGGCCTTGTGACCTGGGGGTGG - Intergenic
1175795598 20:61768954-61768976 GGGCCCTGGTGAGCTGCTGCTGG + Intronic
1176450646 21:6858636-6858658 GGAGCCTGGTGAGATGGTGGAGG + Intergenic
1176803728 21:13459674-13459696 GAGAACTTCTGAGCTGGAGGTGG + Intergenic
1176828816 21:13723654-13723676 GGAGCCTGGTGAGATGGTGGAGG + Intergenic
1177261328 21:18733413-18733435 GGCACCTTGCAAGCTGTTGGTGG - Intergenic
1178354739 21:31901162-31901184 GTCACCTTCTGAGCTGCTGGGGG + Intronic
1179023125 21:37657260-37657282 GGGACTTGGGGAGCTGGTTGGGG + Intronic
1179632727 21:42688667-42688689 GGGAGCAGGTGAGCTGGGGGCGG + Intronic
1179642279 21:42755658-42755680 GGGACCCTGGGAGCTGCTGCAGG - Intronic
1179775400 21:43658854-43658876 GGGGCCTGTTGAGCGGGTGGAGG - Intronic
1183521568 22:38298702-38298724 GGGCCAGAGTGAGCTGGTGGCGG - Intronic
1184028466 22:41876005-41876027 GGGGCGTTGGGAGCTGCTGGAGG + Intronic
1184163744 22:42715097-42715119 GGGGCCTTGAGAGCTGCTGAAGG + Intronic
1184387815 22:44186290-44186312 GAGAACTGGTGAGGTGGTGGTGG + Intronic
1184820996 22:46909241-46909263 GGGGCCTTGTTAAATGGTGGGGG + Intronic
1185139466 22:49092288-49092310 GGGACCTGGTGACGTGGGGGTGG + Intergenic
1185296794 22:50058570-50058592 GGGTCTTTGTGACCTGGTGGGGG - Intergenic
953903937 3:46858788-46858810 GGGATCTTGGGAGAGGGTGGTGG + Intronic
954634348 3:52063471-52063493 GGGATCTTTTGAGAAGGTGGAGG + Intergenic
954689228 3:52386998-52387020 GGGCCCTTGTGTGGTGCTGGTGG - Intronic
954751739 3:52817845-52817867 GGCACCTTGTGTGCAGGTGTGGG - Intronic
957028705 3:75215231-75215253 GGGAACTTTGGAGGTGGTGGAGG + Intergenic
957878846 3:86183986-86184008 AGGAGCATGTGTGCTGGTGGAGG - Intergenic
958597665 3:96250079-96250101 GGAACCTTGTGTGCTGCTGTTGG - Intergenic
959749280 3:109813982-109814004 GGGATCTTGTGTACAGGTGGTGG + Intergenic
960672325 3:120165666-120165688 GGGAGCTGGGGAGCTGGTGAAGG - Exonic
960989527 3:123301598-123301620 GGGAGGTGGTCAGCTGGTGGGGG + Intronic
963486168 3:145936536-145936558 CTGACCTTGTGTGCTGGGGGTGG - Intergenic
964717800 3:159741054-159741076 GGGAGCTTAAGAGCTAGTGGAGG - Intronic
968052765 3:195667046-195667068 GGAACCCTGTGTGCTGTTGGTGG + Intergenic
968089524 3:195891742-195891764 GGATCCTTGGGAGTTGGTGGTGG - Intronic
968103044 3:195981310-195981332 GGAACCCTGTGTGCTGTTGGTGG - Intergenic
968301362 3:197618894-197618916 GGAACCCTGTGTGCTGTTGGTGG - Intergenic
968690228 4:1986455-1986477 GGGACGTTCTGAGCTCGGGGTGG - Intronic
968955997 4:3719924-3719946 GTGTTTTTGTGAGCTGGTGGTGG - Intergenic
969346260 4:6572124-6572146 AGCACTTTGTGAGATGGTGGTGG + Intergenic
969781793 4:9409937-9409959 TGGCCCTTGTGGGCTGGTGCAGG - Intergenic
974134794 4:57801840-57801862 GCGACCATGTGAGCTTATGGTGG + Intergenic
976034707 4:80802520-80802542 GGGAGCTTCTAAGTTGGTGGAGG - Intronic
976050479 4:81006346-81006368 GGGATTTAGTGAGCTGATGGCGG - Intergenic
976674118 4:87685564-87685586 AAGACCTTGTGAGCTGTTGTAGG - Intergenic
983732370 4:171011733-171011755 GGGACCCTTTGAGCTGGAGCTGG - Intergenic
984693926 4:182760115-182760137 GGGACCCTGTTAGCTAGTTGGGG - Intronic
985499011 5:229147-229169 GGAACCCTGTGTGCTGTTGGTGG + Intronic
986061897 5:4199558-4199580 GAGACCTTGTGAGCTGGGCCTGG - Intergenic
986495579 5:8338538-8338560 GGGATCCTGGGTGCTGGTGGAGG - Intergenic
987335971 5:16898125-16898147 GGGGCCCTGTGAGCTGCTTGTGG - Intronic
987621799 5:20344773-20344795 GTGTCCTTCTGAGCTAGTGGAGG - Intronic
988218548 5:28311029-28311051 GGGCACTTCTGAGCTTGTGGTGG - Intergenic
988536513 5:32073822-32073844 GGCTCCTTGTGAGCTGGTGGAGG - Exonic
989507247 5:42241238-42241260 AGGTCTTTGTGAGGTGGTGGTGG - Intergenic
992266585 5:75024511-75024533 GGGAGCTTCTCAGCGGGTGGGGG + Intergenic
994131657 5:96235926-96235948 GGGACCTTGTGATCTGGAATAGG - Intergenic
997720744 5:136076798-136076820 GGTACCTGGTGACCTTGTGGGGG - Intergenic
998388108 5:141769828-141769850 GGGACCTTGGAAACTGATGGGGG + Intergenic
999379449 5:151110026-151110048 GGGTCCTTGTGAACTGGAGAGGG - Intronic
1001826237 5:174747338-174747360 GGGGCATTGTAAGCTGGTGCGGG - Intergenic
1001980076 5:176031763-176031785 GGGGCCCTCAGAGCTGGTGGAGG + Intronic
1002237306 5:177811900-177811922 GGGGCCCTCAGAGCTGGTGGAGG - Intergenic
1002276130 5:178105305-178105327 GGGGCCCTCGGAGCTGGTGGAGG + Intergenic
1002600442 5:180351700-180351722 GTGATTTTGTGAGCTGGAGGAGG + Intronic
1003564400 6:7210931-7210953 AGGACCTTTTTAGCTGGTGCTGG - Exonic
1004071388 6:12301089-12301111 GGGACCTTGTGATCTGGGACAGG + Intergenic
1004201132 6:13549089-13549111 GGGACCTGGTGGGATGTTGGAGG + Intergenic
1006256604 6:32837706-32837728 AGGACGTTGTGAGTTGGAGGTGG - Intronic
1006444436 6:34070856-34070878 GAAACTTTGTGAGCTTGTGGTGG - Intronic
1006672613 6:35738751-35738773 GGGAGCTTGTGGGGTAGTGGGGG - Intronic
1007288152 6:40762997-40763019 GGGGCCTGGGGAGCGGGTGGAGG - Intergenic
1009896188 6:69753465-69753487 GGAACCCTGTGTGCTGCTGGTGG + Intronic
1010512642 6:76739499-76739521 GAAACCTTGTAAGCTGTTGGTGG + Intergenic
1012668936 6:102015781-102015803 GGGACCTGCTGTGCTGGAGGCGG - Intronic
1015483983 6:133747117-133747139 AGGACTTTGTGAGGTGGAGGCGG - Intergenic
1016032703 6:139354467-139354489 GGTCCCTTGTGAGGTGGAGGTGG - Intergenic
1016657876 6:146543083-146543105 GGAACCTTGTACACTGGTGGTGG + Intergenic
1017805078 6:157938759-157938781 GGGTCCTTATGAGGTGCTGGTGG + Intronic
1018580074 6:165301092-165301114 GGGAACTGGTCAGCTGGGGGAGG - Intronic
1018622711 6:165747337-165747359 CAAACCTTGTGAGCCGGTGGAGG - Intronic
1018815793 6:167329833-167329855 GGGAACTGGTGAGATGGTGCTGG - Intronic
1019718555 7:2554637-2554659 GGGGCCCTGAGCGCTGGTGGCGG + Intronic
1020775636 7:12450799-12450821 GGGACCCTGTGAGCTGATGCTGG - Intergenic
1021172325 7:17413828-17413850 GAGACCTGGTGTGCTGGTGCTGG + Intergenic
1021633572 7:22669236-22669258 TGGTCCCTGAGAGCTGGTGGAGG - Intergenic
1021792183 7:24216882-24216904 AGGACCTTGTAAGCTGGGGGTGG - Intergenic
1027684897 7:81267490-81267512 GGGAGTTTGTGGGCAGGTGGTGG + Intergenic
1027874374 7:83749832-83749854 GGGACGTGGTGGGCTGGTGCTGG + Intergenic
1032120787 7:129154312-129154334 GAGACCTTGTCTGTTGGTGGGGG + Intronic
1033333728 7:140435344-140435366 GGGACCTGGTGAGCTGGGCACGG - Intergenic
1033927189 7:146477921-146477943 GGGGCCGTGTGTGCTTGTGGAGG - Intronic
1034319223 7:150164136-150164158 AGGGCCTTGTGAGCTGTTGTTGG + Intergenic
1034773535 7:153803072-153803094 AGGGCCTTGTGAGCTGTTGTTGG - Intergenic
1037367022 8:18133938-18133960 GGGACCCTGTGCGGTGTTGGTGG + Intergenic
1037386406 8:18347414-18347436 GAGAACTTGTGTGCAGGTGGAGG + Intergenic
1038942168 8:32316884-32316906 GGGACCGTGTAGGCTTGTGGTGG + Intronic
1041201372 8:55453945-55453967 GGGCCAGTGTGGGCTGGTGGAGG - Intronic
1041346200 8:56901163-56901185 GTGATATTGTGAGCTAGTGGTGG + Intergenic
1041373637 8:57190742-57190764 GCAAGCGTGTGAGCTGGTGGGGG + Intergenic
1042436857 8:68775993-68776015 GGGACCTGCTGTGGTGGTGGAGG + Intronic
1042695397 8:71548651-71548673 GGGACGCTTTGAGCTGGTAGGGG + Intronic
1043565894 8:81547138-81547160 AGGACTCTGTGAGCTGGTGAAGG - Intergenic
1043658664 8:82706749-82706771 GAGATTTTGTGAGCTGGTAGAGG - Intergenic
1044668357 8:94653850-94653872 TTGACCTTGTTAGCTGGAGGTGG + Intronic
1044935424 8:97289199-97289221 GGGACCATGTGGGATGGAGGAGG + Intergenic
1046363300 8:113190251-113190273 GTAAACTTGTGAGCAGGTGGTGG + Intronic
1046952612 8:120032585-120032607 GTGACCTTGTTGGCTGGTGGGGG + Intronic
1047803121 8:128330778-128330800 GGGAGCTTGAGAGCGGATGGTGG - Intergenic
1049204999 8:141359523-141359545 GGGCCCTTGTGTGGTGGGGGTGG - Intronic
1049211213 8:141387230-141387252 GGGACCCTGTGGCCTGGTGCTGG - Intergenic
1049432675 8:142572477-142572499 TCAGCCTTGTGAGCTGGTGGTGG - Intergenic
1050391593 9:5148903-5148925 GGGACCCTGGGAGGTGCTGGTGG + Intronic
1051202857 9:14648363-14648385 GGGACTTTGTAAGCTGTTGGAGG - Intronic
1053002156 9:34583174-34583196 GAGAGAATGTGAGCTGGTGGAGG + Intronic
1053279225 9:36806634-36806656 GGGAGCTTGTGACCTAGTTGGGG - Intergenic
1055289507 9:74768403-74768425 GGGAGCATTTGAACTGGTGGAGG - Intronic
1057353387 9:94317978-94318000 GGGGCCTTGTGAGTGGATGGTGG + Intergenic
1057438242 9:95062272-95062294 GGGTGCTTGGGACCTGGTGGGGG + Intronic
1057654364 9:96939614-96939636 GGGGCCTTGTGAGTGGATGGTGG - Intronic
1059321881 9:113476460-113476482 GGGATCTTGTGAACTGGGGCAGG + Intronic
1060511812 9:124240091-124240113 GGGCCCCTGTGAGTTGATGGAGG + Intergenic
1060767100 9:126303164-126303186 AGGACTTTGTGTGGTGGTGGTGG + Intergenic
1060941261 9:127544363-127544385 GCAACCTTGTGAGGTGGTGGTGG - Intronic
1061328596 9:129878796-129878818 GGGACCCTGGGAGCTTGTGATGG - Intronic
1061778841 9:132984216-132984238 GGGACCCAGTGAGCAGGAGGAGG - Intronic
1062220705 9:135413643-135413665 TGGACCCTGTGGGCTGGAGGTGG - Intergenic
1062264614 9:135681314-135681336 GGGGCCCTGAGAGCTGGTGGAGG + Intergenic
1062592340 9:137280015-137280037 GGGACCTTGTGGGCTGGTGCAGG + Exonic
1203518536 Un_GL000213v1:25881-25903 GGAGCCTGGTGAGATGGTGGAGG - Intergenic
1186195363 X:7106210-7106232 TGGACTTTGTCAGCTGGTGCTGG - Intronic
1186525632 X:10245418-10245440 GGGACCATGTGAGCTCATGACGG + Intergenic
1186568112 X:10686168-10686190 GTGATCTTGAGAGCTGATGGTGG + Intronic
1187443640 X:19342258-19342280 GGGACATGTTGACCTGGTGGTGG - Intergenic
1187467795 X:19542135-19542157 GGGACCATGGCAGCAGGTGGCGG - Exonic
1187654924 X:21461144-21461166 GGAACCTTGTACGCTGTTGGTGG - Intronic
1189319099 X:40076654-40076676 GGGCCATTGACAGCTGGTGGGGG - Intronic
1190718305 X:53123703-53123725 GGGACCTGTGGAGCTGCTGGAGG - Intergenic
1193111200 X:77732240-77732262 GGGACCTGGCCAGCTGGTGGGGG - Intronic
1197280689 X:124532121-124532143 GCCACCTTGTTAACTGGTGGAGG - Intronic
1198387860 X:136146660-136146682 GGGAGCTTGTAATCTAGTGGGGG - Intergenic