ID: 1152487441

View in Genome Browser
Species Human (GRCh38)
Location 17:80603440-80603462
Sequence GGGGTTGGTGCATCCTTTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 148
Summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 122}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152487434_1152487441 4 Left 1152487434 17:80603413-80603435 CCCTGCGCGCTTTGCAAGAAGCT 0: 1
1: 0
2: 0
3: 2
4: 37
Right 1152487441 17:80603440-80603462 GGGGTTGGTGCATCCTTTGAAGG 0: 1
1: 0
2: 1
3: 24
4: 122
1152487435_1152487441 3 Left 1152487435 17:80603414-80603436 CCTGCGCGCTTTGCAAGAAGCTC 0: 1
1: 0
2: 0
3: 1
4: 43
Right 1152487441 17:80603440-80603462 GGGGTTGGTGCATCCTTTGAAGG 0: 1
1: 0
2: 1
3: 24
4: 122

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152487441 Original CRISPR GGGGTTGGTGCATCCTTTGA AGG Intronic
901446561 1:9311811-9311833 GGGTTTGGTGCATCCCTGGGGGG + Intronic
906251755 1:44315793-44315815 AGGGGTGGTCCATCCTTGGAGGG - Intronic
913415801 1:118605694-118605716 GGGGTTGCTTCAAACTTTGATGG - Intergenic
915526962 1:156481826-156481848 GGGGTCAGTGCCTGCTTTGAAGG - Intronic
916671411 1:167024668-167024690 GTTGTTGCTGCATCCTTTGGAGG - Intergenic
917754196 1:178083060-178083082 GGGGTTGGTGAAATCTTTGAGGG + Intergenic
920164313 1:204024928-204024950 GAGGTGGGTGCATCACTTGAAGG + Intergenic
922275322 1:224072199-224072221 GGGGTTGGGGCATGGTTTCAGGG + Intergenic
922979387 1:229812742-229812764 GGGCTTGGTGCTTTCTTAGAAGG + Intergenic
923610561 1:235488820-235488842 GAGGCTGGTGGATCCCTTGAGGG + Intronic
924906017 1:248453245-248453267 TGGGTTGGTGGTTCCTTGGATGG + Exonic
924921873 1:248638792-248638814 TGGGTTGGTGGTTCCTTGGATGG - Exonic
1066632368 10:37469641-37469663 GAGGTTGGTGCTTCCTTGGAAGG + Intergenic
1075683532 10:124348850-124348872 GAGCTTGGAGCATCCTTGGAGGG - Intergenic
1076364729 10:129914565-129914587 GGGGCTGGTTCCTCCTCTGAGGG + Intronic
1076481710 10:130789148-130789170 TGGGGCGGTGCATCCTCTGAAGG - Intergenic
1077514715 11:2994505-2994527 CGGGTGGGTGGATCCTCTGAGGG + Intergenic
1082587514 11:54960271-54960293 CGGTTTGGTCCATTCTTTGAAGG + Intergenic
1085276840 11:75306069-75306091 GGGTTTGGTGCTTCTTGTGAGGG - Intronic
1091312913 11:134587128-134587150 AGGGCTGGTGCTTCCTTGGAAGG + Intergenic
1091558117 12:1591225-1591247 GAGTTTGGTGCATCCTATGTGGG - Intronic
1092245417 12:6861408-6861430 TGGGTTGGTGGATCCTTCGGAGG - Intronic
1095573643 12:43710183-43710205 GCAGTTGATGAATCCTTTGAAGG + Intergenic
1097293623 12:57941371-57941393 CGGGTTGTTACAGCCTTTGAGGG + Intergenic
1097823737 12:64153775-64153797 GGGCTTGGTGGATCATATGAGGG - Exonic
1098072273 12:66688804-66688826 AGGGTTGTTTCCTCCTTTGAAGG - Intronic
1098187673 12:67915479-67915501 GATGTTGGTAGATCCTTTGAAGG + Intergenic
1101107657 12:101455903-101455925 GGGGTTGGTACTTCCTCTGTGGG - Intergenic
1102592785 12:113969651-113969673 GGGGTTTGGCCATCCTTTGTTGG - Intergenic
1105817275 13:24048049-24048071 GGCGTTGGCCAATCCTTTGAGGG - Intronic
1110313544 13:74078835-74078857 GGGGTAGGTGGTTCCTGTGAGGG - Intronic
1112525552 13:100143296-100143318 GAGGTGGGTGGATCATTTGAGGG + Intronic
1115705735 14:35996070-35996092 GGACTTGGGGGATCCTTTGAAGG - Intergenic
1115763751 14:36601707-36601729 GGTATTGGTGTATCCTTTTAGGG + Intergenic
1115999599 14:39228788-39228810 GGGGATGTTACATCCTTTGTTGG + Intergenic
1117058615 14:51938181-51938203 AGGGTTGGTGAATCCTTTTTTGG - Intronic
1118223755 14:63879522-63879544 GTGGCTGGTGTATCCTATGAAGG + Intronic
1118445091 14:65843452-65843474 GGGATTGATGCATCCTTCAAAGG + Intergenic
1119718629 14:76876187-76876209 GGGGTTGGAGCACCCTCTGCTGG - Intergenic
1120660876 14:87249755-87249777 TGGGTTGGTGCAAACTTGGATGG + Intergenic
1121829340 14:97036052-97036074 GTACTTGGTGCATCCTATGATGG - Intergenic
1128082631 15:64865508-64865530 GATGTTGTTGCATCCTTTGGAGG - Exonic
1131607069 15:93917401-93917423 GGGGTGAGTGCTTCCTTTCATGG + Intergenic
1139340995 16:66267755-66267777 GGGGTAGGTCAGTCCTTTGAGGG + Intergenic
1141131450 16:81440271-81440293 GGGGTTTGTGCACCATTTCATGG + Intergenic
1142740874 17:1931322-1931344 GGGGTGGGTGCATGCTTTGATGG - Intergenic
1143037145 17:4005760-4005782 GGGGTTGGAGCATGCCTTTAGGG - Exonic
1143118587 17:4593983-4594005 GGGGTTGGTGCCTCCTGGTAAGG + Intronic
1143767892 17:9149636-9149658 GGGGCTGGTGCAGCCTTCCAGGG - Intronic
1144216073 17:13056798-13056820 TGGGTTGGTTGATCCTTTGGGGG + Intergenic
1149538056 17:57447672-57447694 GGGGATGATCCATCCTCTGAGGG - Intronic
1149984949 17:61340265-61340287 GGGGCTGGTGCATACATGGAGGG + Intronic
1151977112 17:77489257-77489279 GGGTTTGGTGCGTTCTTAGACGG + Intronic
1152385930 17:79974771-79974793 TGAGTTGGTGCAGCCTTTGCTGG - Intronic
1152487441 17:80603440-80603462 GGGGTTGGTGCATCCTTTGAAGG + Intronic
1153169234 18:2295943-2295965 GGGATTGGTGGATCCTATGGTGG - Intergenic
1153311846 18:3684659-3684681 GGGGTTGGGGCACCCCTTCAGGG + Intronic
1158308221 18:56129636-56129658 GGGTCTGTTGTATCCTTTGAGGG - Intergenic
1158402180 18:57131112-57131134 GCGGTTGGTCCAGCCATTGAAGG - Intergenic
1160457069 18:79008874-79008896 GGGGATGCTGCAGCCTTTGGGGG + Intergenic
1160804399 19:985634-985656 GAGGTTGGTGCTTCCTCTGAGGG - Intronic
1162545541 19:11326905-11326927 GGGCTTCCTGCATCCTTTTAAGG + Exonic
1165767147 19:38358663-38358685 TGGATTTGTGCATCCTTTGAAGG - Intronic
1165919686 19:39288230-39288252 GAGGTGGGTGAATCATTTGATGG - Intergenic
1168001659 19:53451438-53451460 GAGGTTGGTGGATCAGTTGAGGG - Intronic
929869879 2:45750096-45750118 AGGGTTGGTGCATCCTGTTAGGG + Intronic
931090160 2:58877071-58877093 GAGGTTGGTTCATCCTTAAAAGG - Intergenic
932448829 2:71796754-71796776 GGGGTTTGTGCAGCCTTAGCTGG - Intergenic
933515135 2:83290951-83290973 GAGGTTGGTGCATACCTGGATGG - Intergenic
933875893 2:86622444-86622466 AGTGTTGGTGTATCCTTTTAAGG - Intronic
934089342 2:88537811-88537833 GGGGTTGCTGCCTCCTAGGAAGG - Intergenic
944803009 2:203254755-203254777 GAGGTGGGTGGATCGTTTGAGGG + Intronic
945620952 2:212136470-212136492 TGGGTTGGAGAATGCTTTGAAGG - Intronic
947619180 2:231577754-231577776 TGGCTTGGAGGATCCTTTGATGG + Intergenic
947750168 2:232527854-232527876 GGGGTTGGTGCCTCCCTACAGGG + Intronic
1170873297 20:20228324-20228346 GTGGTTGGTGCATCCAGTGTTGG + Exonic
1173423560 20:42924084-42924106 GAGGTGGGTGGATCATTTGAGGG - Intronic
1173621124 20:44436717-44436739 GGGAGTGGTGTATGCTTTGAGGG + Intergenic
1173844680 20:46180431-46180453 GGGGTTGACGCATCCTTTGGGGG - Intronic
1174361873 20:50034003-50034025 GGGGTTGGTGGAGACTGTGATGG + Intergenic
1175594252 20:60217961-60217983 GTGGCTGGTGCATCATTTGAGGG - Intergenic
1175834696 20:61986022-61986044 GGGGATGGTGTTTCCTTTGATGG - Intronic
1175834702 20:61986044-61986066 GGGGATGGTGTTTCCTTTGATGG - Intronic
1175834713 20:61986088-61986110 GGGGATGGTGTTTCCTTTGATGG - Intronic
1175834730 20:61986154-61986176 GGGGATGGTGTTTCCTTTGATGG - Intronic
1175834736 20:61986176-61986198 GGGGATGGTGTTTCCTTTGATGG - Intronic
1175834742 20:61986198-61986220 GGGGATGGTGTTTCCTTTGATGG - Intronic
1175834765 20:61986286-61986308 GGGGATGGTGTTTCCTTTGATGG - Intronic
1175834771 20:61986308-61986330 GGGGATGGTGTTTCCTTTGATGG - Intronic
1175834777 20:61986330-61986352 GGGGATGGTGTTTCCTTTGATGG - Intronic
1175834824 20:61986528-61986550 GGGGATGGTGTTTCCTTTGATGG - Intronic
1176300156 21:5095515-5095537 GGGTTTGGTGCAGCCTCTGATGG + Intergenic
1177141979 21:17367350-17367372 GGGGTTGGTGCATCATTCAAGGG - Intergenic
1179856866 21:44166396-44166418 GGGTTTGGTGCAGCCTCTGATGG - Intergenic
1181041417 22:20194362-20194384 GGGGTTGGTGCCTCTATTGGAGG + Intergenic
1181111534 22:20605653-20605675 GAGGTTGCTGCATCCTTAGCAGG + Intergenic
1181971316 22:26692442-26692464 GGGGATGGTGCATCTTGGGAAGG + Intergenic
1183018346 22:35008059-35008081 AGGGTGGCTGCATCCTTTGTGGG - Intergenic
1184854333 22:47138267-47138289 GGGGTCTGTGCATCCTTAGCTGG - Intronic
952926833 3:38326514-38326536 GGGGCTGGTGCTACCTTTAAAGG + Intergenic
955339746 3:58116267-58116289 GGGGAGGGAGCATACTTTGAGGG + Intronic
956431522 3:69191185-69191207 GAGGTTGGTGTATCACTTGAGGG + Intronic
956867036 3:73379954-73379976 GGGGTTCTTGCATGCTTAGAGGG + Intergenic
960805059 3:121575680-121575702 GAGGTGGGTGGATCATTTGAGGG + Intronic
960910472 3:122644342-122644364 GAGGTTGGTGGATCATTTGAGGG + Intergenic
960977346 3:123188006-123188028 GGGCTAGGGGCATCCTCTGAGGG - Intronic
961636273 3:128335004-128335026 GGGTTTTGTGGATCCTCTGAGGG + Intronic
967175692 3:186862112-186862134 GGGGATTGTGCAGCCTTTGTTGG + Intergenic
969320262 4:6408243-6408265 GGGGTTTTTGCATCCTTTTGGGG - Intronic
974205650 4:58700016-58700038 GGGGTTGGTTCCTTCTTTGGAGG + Intergenic
974850803 4:67403293-67403315 GGGCATGGTGCATGCTTTGGGGG - Intergenic
976115559 4:81722490-81722512 GGGCTTGCTGGACCCTTTGAAGG - Intronic
999452201 5:151686815-151686837 GGGGTTGGTGCAACTATAGAAGG + Intronic
1000994448 5:167944704-167944726 GGGTATGTTGTATCCTTTGAGGG + Intronic
1002461784 5:179377510-179377532 GGGTTTGGTGCATTCTTTCCTGG - Intergenic
1005048325 6:21663200-21663222 GAGGTGGGTGGATCATTTGAGGG - Intergenic
1007096221 6:39214838-39214860 GGGGTTGGGGCATATTGTGAGGG - Intronic
1007641365 6:43342516-43342538 GGGGATGGTGTCTCCTTTGTTGG + Intronic
1008331074 6:50245553-50245575 GGGGTTGGCCCATGCTTTGTTGG + Intergenic
1009052201 6:58289668-58289690 GGGGTTGGGGCATGCTTTTGGGG + Intergenic
1014469390 6:121796710-121796732 GGTGTTAGTTAATCCTTTGAGGG + Intergenic
1019514038 7:1431989-1432011 GGGGTTGGGGCAGCCTCTGCAGG + Intronic
1022046681 7:26627408-26627430 GGGGTTGTTGACTCCTCTGAGGG + Intergenic
1024575389 7:50759443-50759465 GGGACTGGAGCATCCTCTGATGG - Intronic
1025991851 7:66503227-66503249 GGGGCTGGTGCATCCATTGCTGG - Intergenic
1032607881 7:133377118-133377140 GAGGTAGGTGGATCATTTGAGGG + Intronic
1033942954 7:146678303-146678325 GAGGTTGGTGGATCACTTGAGGG - Intronic
1034461995 7:151203173-151203195 TGTCCTGGTGCATCCTTTGATGG - Intronic
1035647882 8:1242486-1242508 GGGGTTGGTGCAACATTCCAGGG - Intergenic
1038027509 8:23605416-23605438 GGGTTCTGTGTATCCTTTGAGGG - Intergenic
1039912008 8:41833382-41833404 GGGGGTGGTGCCTCCTTTCTGGG + Intronic
1040457842 8:47617528-47617550 GGTGATGCTGCATCTTTTGATGG - Intronic
1043178896 8:77058670-77058692 GGTGTTGGTGCATCCTGTCCAGG + Intergenic
1046226529 8:111287112-111287134 CTTGTTGCTGCATCCTTTGACGG - Intergenic
1047691187 8:127356289-127356311 GGGGGTGGTGGGTCCTTGGATGG + Intergenic
1049015530 8:139917555-139917577 GGTGTTGGTGCATTCTCCGATGG - Intronic
1049395986 8:142401005-142401027 GGCGTGGGTGCATCCTTCCACGG - Intronic
1049733108 8:144189252-144189274 GCGGTGGGTGCATCCTTTCAGGG + Intronic
1057215970 9:93228966-93228988 GGGGTTGGTGGTTCCCTTGTGGG + Intronic
1057303902 9:93901710-93901732 GGCGTAGGTGCATCCTTTGGGGG - Intergenic
1058974191 9:110110776-110110798 GGGGCAGGTGGATCATTTGAGGG - Intronic
1059638940 9:116197330-116197352 GGGGCTGGTCAATCCTCTGAAGG - Intronic
1059970794 9:119666223-119666245 GGATTTGGTGCAGCATTTGAAGG - Intergenic
1061509771 9:131053270-131053292 GGGCTTGGTGGATCCAGTGAAGG - Intronic
1190164161 X:48058136-48058158 GGGCATGGTGCATTATTTGAAGG - Intronic
1192991273 X:76460197-76460219 GAGGCTGGTGGATCATTTGAGGG - Intergenic
1198318541 X:135494840-135494862 GAGGTCGGTGGATCATTTGAGGG + Intergenic
1198321020 X:135519345-135519367 GAGGTGGGTGGATCATTTGAGGG - Intergenic