ID: 1152490840

View in Genome Browser
Species Human (GRCh38)
Location 17:80632298-80632320
Sequence CACAGGGATCCGCATGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 173
Summary {0: 1, 1: 0, 2: 2, 3: 7, 4: 163}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152490840_1152490846 -7 Left 1152490840 17:80632298-80632320 CCTTCCTCATGCGGATCCCTGTG 0: 1
1: 0
2: 2
3: 7
4: 163
Right 1152490846 17:80632314-80632336 CCCTGTGTGTGCTCCGGGGACGG 0: 1
1: 0
2: 1
3: 25
4: 243
1152490840_1152490848 -6 Left 1152490840 17:80632298-80632320 CCTTCCTCATGCGGATCCCTGTG 0: 1
1: 0
2: 2
3: 7
4: 163
Right 1152490848 17:80632315-80632337 CCTGTGTGTGCTCCGGGGACGGG 0: 1
1: 0
2: 1
3: 21
4: 243
1152490840_1152490852 12 Left 1152490840 17:80632298-80632320 CCTTCCTCATGCGGATCCCTGTG 0: 1
1: 0
2: 2
3: 7
4: 163
Right 1152490852 17:80632333-80632355 ACGGGACGCGCAGGCCCTTCGGG 0: 1
1: 0
2: 0
3: 6
4: 48
1152490840_1152490854 22 Left 1152490840 17:80632298-80632320 CCTTCCTCATGCGGATCCCTGTG 0: 1
1: 0
2: 2
3: 7
4: 163
Right 1152490854 17:80632343-80632365 CAGGCCCTTCGGGGTTGTGTAGG 0: 1
1: 0
2: 0
3: 4
4: 74
1152490840_1152490849 3 Left 1152490840 17:80632298-80632320 CCTTCCTCATGCGGATCCCTGTG 0: 1
1: 0
2: 2
3: 7
4: 163
Right 1152490849 17:80632324-80632346 GCTCCGGGGACGGGACGCGCAGG 0: 1
1: 0
2: 0
3: 15
4: 181
1152490840_1152490853 13 Left 1152490840 17:80632298-80632320 CCTTCCTCATGCGGATCCCTGTG 0: 1
1: 0
2: 2
3: 7
4: 163
Right 1152490853 17:80632334-80632356 CGGGACGCGCAGGCCCTTCGGGG 0: 1
1: 0
2: 1
3: 2
4: 65
1152490840_1152490851 11 Left 1152490840 17:80632298-80632320 CCTTCCTCATGCGGATCCCTGTG 0: 1
1: 0
2: 2
3: 7
4: 163
Right 1152490851 17:80632332-80632354 GACGGGACGCGCAGGCCCTTCGG 0: 1
1: 0
2: 0
3: 3
4: 57

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152490840 Original CRISPR CACAGGGATCCGCATGAGGA AGG (reversed) Intronic
900114420 1:1022406-1022428 CAGGGTGATCCGCATGAGGCTGG - Exonic
902186456 1:14729116-14729138 CACATGGATCAGGATGGGGAAGG + Intronic
902806663 1:18865391-18865413 CACAGGTATGAGCATGGGGACGG - Intronic
902989736 1:20178431-20178453 CCCAGGGATCTGCAGCAGGATGG - Intergenic
904810617 1:33161292-33161314 CAGAGGGAGCCGCATGAGGAAGG + Intronic
904914621 1:33960936-33960958 CACAGGGATCAGGAAAAGGATGG - Intronic
906182322 1:43832828-43832850 GAAAGGCATCCTCATGAGGAAGG + Intronic
906304203 1:44706191-44706213 CACAGGGAACCACTTGAGGCTGG + Intronic
912509246 1:110177038-110177060 CAAAGGGAACTGCATGAGCAAGG + Intronic
913085877 1:115436069-115436091 CACAGGGATGGGCAGGAAGAGGG - Intergenic
917487842 1:175470876-175470898 CACAGGGTTGGGCATGAGGTGGG + Intronic
921336198 1:214089005-214089027 CACTGGGATCTGCTTGAGGGTGG - Intergenic
922916621 1:229263329-229263351 CACAGGGCACCTCATGAGGAGGG - Intergenic
1062985104 10:1761344-1761366 CACAGGGATAGGCATGAAAAAGG - Intergenic
1068657808 10:59592878-59592900 CACAGGGAGCTGCCTGAAGACGG + Intergenic
1075723247 10:124599219-124599241 CACAGGGATGGACAGGAGGATGG - Intronic
1077469240 11:2749095-2749117 CACATGGGGCCGCAGGAGGAAGG + Intronic
1078123008 11:8529615-8529637 CACAAGGATCCCTATAAGGAGGG + Intronic
1079414257 11:20218347-20218369 CACTGGGACCCACATGGGGAAGG + Intergenic
1081700585 11:45150138-45150160 CAGAAGGAACAGCATGAGGAAGG - Intronic
1085965863 11:81525255-81525277 CAATGGGATCTGCTTGAGGAGGG - Intergenic
1087959064 11:104325654-104325676 CACTGGGGTCCACTTGAGGATGG + Intergenic
1089291816 11:117441822-117441844 CAGAGGGGTCCACATGAAGACGG + Intronic
1089910230 11:122091437-122091459 CAGAGGAATACACATGAGGAAGG + Intergenic
1090442042 11:126732367-126732389 CTCAGGGGTCCTCATGAGAAGGG - Intronic
1090493769 11:127190154-127190176 CACAGTGATACCCTTGAGGAGGG + Intergenic
1091239691 11:134044094-134044116 CAGAGGGAGCTGCATGGGGAAGG - Intergenic
1093422662 12:18992846-18992868 CACAGGGAAAAGCATGAGGCTGG + Intergenic
1104492057 12:129202743-129202765 CAGAGGGAATGGCATGAGGAAGG - Intronic
1104742865 12:131191585-131191607 CACTGGGATCACCCTGAGGATGG + Intergenic
1106835778 13:33633881-33633903 CACAGGGAGCCCCAAGAGGGTGG - Intergenic
1113815975 13:113171501-113171523 CTCAGGGAGCCACGTGAGGAGGG - Intronic
1118260806 14:64244944-64244966 AACAGTGATCCCCAGGAGGAGGG - Intronic
1118475512 14:66112622-66112644 CACAGGAGTCTCCATGAGGAGGG - Intergenic
1118760758 14:68879168-68879190 CACAGGGACAGGCATGCGGAGGG + Intronic
1119112767 14:71990360-71990382 CACATGGTTCCAAATGAGGAAGG + Intronic
1123160540 14:106274621-106274643 CTCAGGGCTTCACATGAGGAGGG - Intergenic
1123185085 14:106508985-106509007 CTCAGGGCTGCACATGAGGAGGG - Intergenic
1123205903 14:106713209-106713231 CTCAGGGCTGCACATGAGGAGGG - Intergenic
1123208293 14:106735226-106735248 CTCAGGGCTGCACATGAGGAGGG - Intergenic
1123210983 14:106760614-106760636 CTCAGGGCTGCACATGAGGAGGG - Intergenic
1123398686 15:19962951-19962973 CTCAGGGCTGCACATGAGGAGGG - Intergenic
1124349189 15:28943066-28943088 CTCAAGGAACCGCGTGAGGAAGG - Intronic
1124422857 15:29537781-29537803 GACAGGGATCCCCATCAGTAGGG - Intronic
1129410520 15:75348130-75348152 CCCATGGCTCCGCAGGAGGACGG - Intronic
1132101152 15:99024403-99024425 CAGAGGGAGCCCCAGGAGGATGG - Intergenic
1133546711 16:6814676-6814698 CACAGGGAGCAGCATGTGGAAGG + Intronic
1135178455 16:20252100-20252122 CAAGGGGATCCCCATGAGGCTGG - Intergenic
1135883890 16:26286430-26286452 TGCAGAGATCCACATGAGGAAGG - Intergenic
1135991274 16:27220295-27220317 CCCAGGGAGCAGCATGTGGAAGG + Intronic
1136710778 16:32234770-32234792 CACAGGGAGGCACATGGGGAGGG - Intergenic
1136757133 16:32694641-32694663 CACAGGGAGGCACATGGGGAGGG + Intergenic
1136810976 16:33175734-33175756 CACAGGGAGGCACATGGGGAGGG - Intergenic
1136817452 16:33285814-33285836 CACAGGGAGGCACATGGGGAGGG - Intronic
1136824016 16:33342343-33342365 CACAGGGAGGCACATGGGGAGGG - Intergenic
1141206794 16:81939044-81939066 CACATGGTTCAGCTTGAGGAGGG + Intronic
1141629929 16:85281934-85281956 CACAGGGCTCTGCATGTGGGTGG - Intergenic
1142332847 16:89466368-89466390 CACAGGGGACCGCATGAGGATGG + Intronic
1203059282 16_KI270728v1_random:954992-955014 CACAGGGAGGCACATGGGGAGGG + Intergenic
1143551285 17:7631886-7631908 CCCAGGGCTCTGCATGAGGCTGG - Exonic
1143942456 17:10556778-10556800 TACAGGCATCAGCAGGAGGAAGG - Intergenic
1147376821 17:40027404-40027426 CACATGGCACAGCATGAGGAAGG + Exonic
1149349003 17:55768464-55768486 CTCAGGGATCAGCATTAGTAAGG + Intronic
1150568068 17:66360591-66360613 AACAGGGATACTAATGAGGAAGG + Intronic
1150769731 17:68030809-68030831 CACTGGGAGCCCTATGAGGAAGG - Intergenic
1151012548 17:70517152-70517174 CCCAGGAATCTTCATGAGGAAGG + Intergenic
1152490840 17:80632298-80632320 CACAGGGATCCGCATGAGGAAGG - Intronic
1152892682 17:82891393-82891415 CACAGTGACCAGCATGCGGACGG + Intronic
1153608830 18:6861242-6861264 CTCAGAGATGCGCATGAAGAGGG - Intronic
1157499218 18:48178203-48178225 CACAGGGGTCCGCATGAGTCAGG - Intronic
1157710570 18:49847150-49847172 CACCAGGTTCCGGATGAGGAGGG + Exonic
1157976828 18:52337703-52337725 CACAGGGATACAGATGAAGATGG - Intergenic
1160174186 18:76579494-76579516 CACAGGGAGCCTGGTGAGGAGGG - Intergenic
1160880775 19:1318990-1319012 CCCAGGGATCCTCATTAGGCAGG - Intergenic
1161511805 19:4676211-4676233 CACAGGGAGCCCCAGGCGGAAGG + Exonic
1161767796 19:6216635-6216657 CACAGGGACCCCCAGGTGGACGG - Intronic
1161851480 19:6740005-6740027 CACAGGGTTGCGAATGAGGCGGG + Intronic
1167334372 19:48875549-48875571 CACGGGAATCCGGATGGGGAGGG - Intronic
1167597889 19:50436818-50436840 CACAGGCATGGGCATGAGGTGGG + Intronic
1167625086 19:50582736-50582758 AAAAGGGAGCCGCATGAGGTGGG + Intergenic
1167795030 19:51703446-51703468 CACAAGCATCAGCAAGAGGAGGG + Intergenic
1167937939 19:52922888-52922910 AACAGGGCCCGGCATGAGGAGGG + Intergenic
926155915 2:10454008-10454030 GACAGGGAGCAGCATGCGGAGGG + Intergenic
928296626 2:30089550-30089572 CACAGGGATTCAAATAAGGAAGG - Intergenic
929001066 2:37347282-37347304 CACAGCAAGCCCCATGAGGAAGG + Intronic
929368829 2:41196256-41196278 CACAGGGATCCACTTGAGCAGGG + Intergenic
930533447 2:52618162-52618184 CAAATGGATTCGCATGAGCAGGG + Intergenic
932660114 2:73644307-73644329 CACAGGGAGGAGGATGAGGAAGG + Intergenic
932666681 2:73703988-73704010 CACAGGGAGGAGGATGAGGAAGG + Intergenic
933216733 2:79638651-79638673 CACAGGAAACTGCATGAGGCAGG + Intronic
933540413 2:83634082-83634104 CACAGGGAACTACAAGAGGAGGG + Intergenic
934753449 2:96809306-96809328 CCGAGTGATCTGCATGAGGAAGG - Exonic
936159086 2:110070620-110070642 CGCTGGGAACAGCATGAGGAAGG - Intergenic
936185575 2:110300712-110300734 CGCTGGGAACAGCATGAGGAAGG + Intergenic
937307769 2:120882615-120882637 CCCAGGGATCCGACAGAGGAGGG - Intronic
937670453 2:124532562-124532584 AACAGGGATGCTGATGAGGAAGG + Intronic
937970029 2:127542237-127542259 CCCAGGGCTCCCCATGAAGAAGG - Intronic
938937274 2:136138071-136138093 CACTGTTATCAGCATGAGGATGG - Intergenic
940016446 2:149111144-149111166 CAGAGGGACCCCCAGGAGGATGG + Intronic
943848847 2:192689581-192689603 CACAGGGATGTGCATGCAGAGGG - Intergenic
947720749 2:232367995-232368017 CAGAGGGCACCGCAGGAGGAAGG - Intergenic
1169126928 20:3135482-3135504 CAAACGGAGCCGGATGAGGAAGG + Intronic
1170143242 20:13146260-13146282 CACTGGGATCTGCTTGAGGGAGG + Intronic
1170484511 20:16803101-16803123 CACAGGGATTCCCTTGAAGAAGG - Intergenic
1171106588 20:22439216-22439238 CACTGGGAGGTGCATGAGGAAGG - Intergenic
1171234405 20:23512629-23512651 CACAGGCATCCCCCTGATGAGGG - Intergenic
1172093028 20:32446942-32446964 CACTGGGATCTGCAACAGGATGG + Exonic
1173690587 20:44957976-44957998 CACAGGGATAAGGATGGGGATGG - Intronic
1174186898 20:48712517-48712539 CACAGGGAACCACTGGAGGAGGG - Intronic
1176745377 21:10647694-10647716 CTCAGGGCTGCACATGAGGAGGG - Intergenic
1179270208 21:39845010-39845032 CAAAGGCATCCTCATGAAGAGGG - Intergenic
1179520446 21:41940418-41940440 CACAGGGATACGTAAGAGGTGGG + Intronic
1179972930 21:44846200-44846222 TTCAGGGACCTGCATGAGGAAGG - Intergenic
1181469043 22:23126827-23126849 CACAGGGAGCCACATGATGGTGG - Intronic
1182127884 22:27829393-27829415 CTGAGGGAACAGCATGAGGAAGG + Intergenic
1182718004 22:32375610-32375632 CCCAGGGATCTGGAGGAGGAAGG - Intronic
1183715817 22:39532822-39532844 CAGAGGGATCCGGAGGGGGATGG + Exonic
1183964083 22:41430915-41430937 CCCAGGGAGCCCCATCAGGAGGG - Intergenic
1184071829 22:42151610-42151632 CCCTGGGATGCGCAGGAGGAGGG + Intergenic
1185196302 22:49472079-49472101 CACAGAGATGCCCATCAGGATGG - Intronic
1185307267 22:50126737-50126759 TACTGGGATCTGCATGAGAAGGG + Intronic
950458495 3:13106697-13106719 CCCATGGAGCCGCAGGAGGAGGG - Intergenic
952228095 3:31399932-31399954 CACTGGGATCTGCTTGAGGGTGG - Intergenic
953783423 3:45892544-45892566 CACTGGGACCCCCTTGAGGATGG + Intronic
961219396 3:125187763-125187785 CAGGGGAATCAGCATGAGGAGGG - Intronic
963925914 3:150951127-150951149 CACTGGGATCTTCTTGAGGATGG + Intronic
965321979 3:167261950-167261972 CACAGGGATCCAAAAGAGCAAGG - Intronic
965609261 3:170527288-170527310 CACAGTCATCCTGATGAGGATGG + Intronic
966474243 3:180325533-180325555 CACAGGGATCTGCACCAAGAAGG - Intergenic
973838779 4:54839726-54839748 CACTGGGATCTGCTTGAGGGTGG + Intergenic
974942884 4:68489924-68489946 CACAGGGTTTGGCATGAGAATGG - Intronic
977001919 4:91515364-91515386 CACTGGGATCTACTTGAGGATGG - Intronic
978167457 4:105625879-105625901 AAGAAGGATCAGCATGAGGAAGG - Intronic
978448613 4:108804911-108804933 CTGAGGTATCTGCATGAGGATGG + Intergenic
982122429 4:152156077-152156099 CACAGGGAACAGCCTGAAGAGGG - Intergenic
984951220 4:185009220-185009242 GACAGGGTTTGGCATGAGGAAGG - Intergenic
985652572 5:1113708-1113730 CCCAGGCATCCTTATGAGGAGGG + Intergenic
988129332 5:27081877-27081899 CACAGGGGTCTACTTGAGGAGGG + Intronic
989389867 5:40888873-40888895 CACTGGGATGGGCATGAAGATGG - Intergenic
989462426 5:41716036-41716058 CACAGGGCTCTGGATGAGCAGGG + Intergenic
995082513 5:108069802-108069824 TTCAGGCATCTGCATGAGGAAGG - Intronic
997211295 5:132078534-132078556 CACAGGGATCAGCATGGGATAGG + Intergenic
1000351389 5:160355470-160355492 CTCAGGGTTGCACATGAGGAGGG + Intronic
1005938880 6:30546163-30546185 GACCGGGATGCGGATGAGGAGGG - Exonic
1006915992 6:37594249-37594271 CACAGGCATGAACATGAGGAAGG + Intergenic
1014422995 6:121267802-121267824 GACAGGGACCCACTTGAGGAGGG - Intronic
1015021327 6:128479344-128479366 CGCAGTGATCTACATGAGGATGG - Intronic
1015774335 6:136798407-136798429 GGCAGGGATCTGCAGGAGGAAGG + Intergenic
1016888966 6:148986735-148986757 CACAGGGATTCCGAGGAGGAGGG - Intronic
1018082387 6:160269794-160269816 CACAGGGTAGAGCATGAGGATGG - Intronic
1023881470 7:44323909-44323931 CTCAGGGATCCGCATGAAGGGGG + Intronic
1027202951 7:76074340-76074362 TACAGGGACCAGCATGAGGCAGG + Intergenic
1033736712 7:144229507-144229529 CACAGGCAACCGCCTGAGCATGG + Intergenic
1033746345 7:144321443-144321465 CACAGGCAACCGCCTGAGCATGG - Intergenic
1034156183 7:148957929-148957951 CACTGGGATCTGCTTGAGGGTGG - Intergenic
1034737656 7:153443960-153443982 CACAGGGCTCCGCAGGAGGTGGG + Intergenic
1037250462 8:16887303-16887325 CAAAGGGATCAGCATGTGCATGG + Intergenic
1039028221 8:33281416-33281438 CACTGGGATCTACCTGAGGATGG + Intergenic
1039548733 8:38428523-38428545 GACTGGGATCCCCATGGGGAGGG - Intronic
1046499230 8:115054287-115054309 CACTGGGATCTACTTGAGGATGG - Intergenic
1053509803 9:38678099-38678121 CACTGGGATCTCCATGAGGAGGG + Intergenic
1055343678 9:75311879-75311901 CAGAGGGATCCCCATCAGGCTGG - Intergenic
1056477795 9:86969509-86969531 CCCAGAGATCTGCATGAGCAGGG - Intergenic
1057282762 9:93724816-93724838 CACAGGGAAGAGCATGAGCAAGG + Intergenic
1059469798 9:114496139-114496161 CCCAGGGACCCTGATGAGGAGGG - Intronic
1059511257 9:114850290-114850312 CACAGGGACCTACTTGAGGAGGG + Intergenic
1061597996 9:131645022-131645044 CCCAGGGATGGGGATGAGGAAGG - Intronic
1061901349 9:133673820-133673842 AACAGGGATCCGCAATTGGAGGG - Intronic
1186938039 X:14472751-14472773 CACAGAGATTCAGATGAGGAAGG + Intergenic
1188582824 X:31735932-31735954 CACAAGGATCTGCATTAGAAGGG + Intronic
1193040398 X:76998457-76998479 GTCAGGGATCCACTTGAGGAGGG + Intergenic
1196505181 X:116433943-116433965 CACAGGGATATGAATGAGCATGG - Intergenic
1196894616 X:120322573-120322595 CACAGGGATCTGACTCAGGATGG + Intergenic