ID: 1152491967

View in Genome Browser
Species Human (GRCh38)
Location 17:80641060-80641082
Sequence GGCCACGAAGTACACAAACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 85
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 75}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152491967_1152491974 22 Left 1152491967 17:80641060-80641082 CCTTGTTTGTGTACTTCGTGGCC 0: 1
1: 0
2: 1
3: 8
4: 75
Right 1152491974 17:80641105-80641127 CCAATCCAATCCTATCTTGTGGG 0: 1
1: 0
2: 0
3: 8
4: 112
1152491967_1152491972 21 Left 1152491967 17:80641060-80641082 CCTTGTTTGTGTACTTCGTGGCC 0: 1
1: 0
2: 1
3: 8
4: 75
Right 1152491972 17:80641104-80641126 CCCAATCCAATCCTATCTTGTGG 0: 1
1: 0
2: 0
3: 4
4: 82

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152491967 Original CRISPR GGCCACGAAGTACACAAACA AGG (reversed) Intronic
901391158 1:8947188-8947210 GTCCACAAAGTCCACAGACACGG - Intronic
905628731 1:39506709-39506731 TGCTAGGAAGTACACAAAGAAGG - Intronic
905828999 1:41049214-41049236 GGCAACCAAGTACAAAAAAATGG - Intronic
913197110 1:116466243-116466265 GGCCAGCAAGAGCACAAACAGGG + Intergenic
922899807 1:229127909-229127931 GGCCACTTAGAACAAAAACATGG - Intergenic
923972270 1:239217785-239217807 GGTCACAAGGTACACAGACAGGG + Intergenic
1063128840 10:3160169-3160191 TACCAGGAAGGACACAAACACGG + Intronic
1065547551 10:26837208-26837230 GGCCAGGAAGTCCACAATCAAGG + Intronic
1072865431 10:99055288-99055310 GGCAACTAAATACACATACAAGG + Intronic
1076318633 10:129562396-129562418 GGCCTCGTGGTACAAAAACATGG + Intronic
1076982458 11:212009-212031 GTCCACGAAGTACACAGAGCGGG + Intronic
1078226628 11:9397666-9397688 GCCCACAAAGCACACATACATGG - Intronic
1079007242 11:16800641-16800663 GGCCAAGAACTACAGGAACATGG + Intronic
1083721811 11:64607210-64607232 GGCCAAGAAGAACAAAGACAAGG - Exonic
1088384375 11:109236891-109236913 GGACACTCAGTACACAAAGATGG - Intergenic
1096449090 12:51722066-51722088 GGCCAGGAAGAACACAGAAATGG - Intronic
1096960626 12:55573436-55573458 GCCCATGAAGTACCCAAATATGG + Intergenic
1099774610 12:87109523-87109545 GGATAGGAATTACACAAACATGG + Intergenic
1100618056 12:96247084-96247106 GGCCGCGAGGCCCACAAACACGG + Exonic
1103602038 12:122060362-122060384 GGCCTCGAAGGCCACAAACAAGG + Exonic
1104073021 12:125363053-125363075 TGCCACGTTGAACACAAACAAGG + Intronic
1105046208 12:133005811-133005833 GGCCAGGAAGTCCATAAGCATGG - Intronic
1108968317 13:56340032-56340054 GGCCAAGAAGATCCCAAACAAGG + Intergenic
1109290799 13:60473093-60473115 GGCCCAGAAGTACAATAACATGG + Intronic
1112621391 13:101057541-101057563 TGCCACGAAGTTCTCAAAAAAGG - Intronic
1114483357 14:23048457-23048479 GGCCACGAAGAGCACCACCAGGG + Exonic
1117292487 14:54347166-54347188 TGCCAGGAAGGAAACAAACAGGG + Intergenic
1119588577 14:75862615-75862637 TGCTAGGAAGTACACAGACATGG + Intronic
1122752773 14:103950955-103950977 GGCTACAAAGATCACAAACAGGG - Intronic
1124048354 15:26172170-26172192 AGCCAATAAGTACAGAAACAAGG + Intergenic
1126019397 15:44385476-44385498 GGCCAGAAAGTACACAGAAAAGG - Intronic
1134341269 16:13348855-13348877 GGCCACAAAGTATACAAATGAGG - Intergenic
1134679564 16:16114772-16114794 GGCCATGGAGTAGCCAAACACGG - Exonic
1134793517 16:17013025-17013047 GGCCACGTAGTGCAGAATCAGGG + Intergenic
1135496521 16:22956466-22956488 GGCCACCAAGTACAGCAACACGG - Intergenic
1137503148 16:49026680-49026702 GGCCATGAACGACACTAACAAGG - Intergenic
1141162320 16:81637834-81637856 GGCCAGGAAGTCCACCATCAAGG + Intronic
1143037335 17:4006919-4006941 GGCCATCAACTACCCAAACAAGG - Exonic
1148882993 17:50745973-50745995 GGTCACGAAGTAGAGAAAGAAGG + Exonic
1151707372 17:75776767-75776789 GGAAACAAAGTACACAAACCTGG - Exonic
1152491967 17:80641060-80641082 GGCCACGAAGTACACAAACAAGG - Intronic
1159814616 18:73057549-73057571 AGCCAAGAAGTACAAAACCAAGG - Intergenic
1162895664 19:13763524-13763546 GGCCAGGAACCACACACACAAGG + Intergenic
927133837 2:20082395-20082417 GGCCAGGAAGTCCAAAAGCATGG - Intergenic
940204996 2:151192913-151192935 CGCTAGGAAGGACACAAACAAGG + Intergenic
944523461 2:200594837-200594859 GGCAGAGAAATACACAAACATGG + Intronic
1171057399 20:21920839-21920861 GCCCATGGAGTACACGAACAGGG - Intergenic
1171152116 20:22836278-22836300 GGTCAGGAAGGACACAAGCAAGG - Intergenic
1177790010 21:25712944-25712966 GGCCAGGAAGTCCACAATCAAGG + Intronic
1178943268 21:36925363-36925385 GGCCACGATGAACACCCACAAGG + Intronic
1180868756 22:19134390-19134412 GGCCAGCAAGTACACAGACCGGG - Exonic
1183095816 22:35551747-35551769 GGCCAAGAAGAACACCAACGTGG + Exonic
963398418 3:144763935-144763957 GGCAGAGAAGTAGACAAACAAGG - Intergenic
968696876 4:2034942-2034964 GGACACGAAGTCCAGCAACAAGG + Intronic
970429096 4:15972334-15972356 GGCCACGAAGTCCAAGAACCTGG + Intronic
970799467 4:19954928-19954950 GGCCAAGAAGTACCAGAACAAGG + Intergenic
971986224 4:33828721-33828743 GGCCACCATGTACTCAAACAAGG - Intergenic
972198806 4:36687446-36687468 GGGCACTATGTACACAAATATGG - Intergenic
977104873 4:92869512-92869534 GGACACCAAGGACACAAAGATGG - Intronic
982924887 4:161323160-161323182 GGCTACGAAGTACAAGATCAAGG - Intergenic
985186784 4:187326068-187326090 GGCCATGGAAAACACAAACATGG - Intergenic
988052488 5:26049156-26049178 GGCCAGGAAGTCCACAATCAAGG + Intergenic
990462237 5:56039957-56039979 TGCCATGAAGAACACAAACAGGG - Intergenic
993681738 5:90886568-90886590 AGTCACGAAGTATACAAAAATGG - Intronic
1003116122 6:3284849-3284871 TGCCAAGCAGCACACAAACAGGG + Intronic
1004371972 6:15060548-15060570 GGCCAGGAAGTCCAAAATCAAGG + Intergenic
1005143800 6:22664464-22664486 GTCCACCAGGTACGCAAACAAGG - Intergenic
1006795736 6:36731284-36731306 GGCCATGAAGGACACAAACAGGG - Intronic
1009985503 6:70777380-70777402 GGCCAACAAGTACATAAAAAAGG - Intronic
1014967383 6:127772241-127772263 GGTCAAAAAGTACACATACAAGG + Intronic
1029457651 7:100679196-100679218 GGCAACAAAGTCCAGAAACAAGG - Intergenic
1045219271 8:100181543-100181565 GGGCTAGAAGTACACAATCAAGG + Intronic
1048765063 8:137834751-137834773 GGCCAGGAGGTGAACAAACAAGG + Intergenic
1049966597 9:785654-785676 GGCCATGGAGAACACAGACAGGG + Intergenic
1051006540 9:12352324-12352346 GGCAACGAAGTGTGCAAACAGGG - Intergenic
1055791217 9:79925087-79925109 GGCCACGTACTAGACAAATAGGG - Intergenic
1056677942 9:88692261-88692283 GGTCACCAAGTAGACACACATGG - Intergenic
1056761908 9:89421381-89421403 GGCTACAAAGTACACAGACAGGG + Intronic
1059621651 9:116012353-116012375 AGTCATTAAGTACACAAACACGG + Intergenic
1062045817 9:134424007-134424029 GGCCAGGCACCACACAAACATGG - Intronic
1062233212 9:135494780-135494802 GAGCATGAAGCACACAAACATGG + Intergenic
1190231526 X:48585930-48585952 GGCCACCAGGTATACAAAAAGGG - Intergenic
1192762411 X:74106981-74107003 GACCATGAAGTCCACCAACATGG - Intergenic
1195204534 X:102583212-102583234 AGCCATGAAGTACACAAAGCTGG + Intergenic
1198371131 X:135990284-135990306 GGCAACAAAGAACACAACCATGG - Intronic