ID: 1152494456

View in Genome Browser
Species Human (GRCh38)
Location 17:80661128-80661150
Sequence CACGGGACCAGGATTGGAAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 142
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 132}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152494450_1152494456 -10 Left 1152494450 17:80661115-80661137 CCTGGCCCCTGAGCACGGGACCA 0: 1
1: 0
2: 0
3: 13
4: 146
Right 1152494456 17:80661128-80661150 CACGGGACCAGGATTGGAAGTGG 0: 1
1: 0
2: 0
3: 9
4: 132
1152494449_1152494456 -9 Left 1152494449 17:80661114-80661136 CCCTGGCCCCTGAGCACGGGACC 0: 1
1: 0
2: 0
3: 16
4: 153
Right 1152494456 17:80661128-80661150 CACGGGACCAGGATTGGAAGTGG 0: 1
1: 0
2: 0
3: 9
4: 132
1152494443_1152494456 30 Left 1152494443 17:80661075-80661097 CCACACTTAAGGTTCTCTTCTGC 0: 1
1: 0
2: 0
3: 6
4: 155
Right 1152494456 17:80661128-80661150 CACGGGACCAGGATTGGAAGTGG 0: 1
1: 0
2: 0
3: 9
4: 132
1152494446_1152494456 5 Left 1152494446 17:80661100-80661122 CCATCTTCTGTCGGCCCTGGCCC 0: 1
1: 0
2: 3
3: 20
4: 229
Right 1152494456 17:80661128-80661150 CACGGGACCAGGATTGGAAGTGG 0: 1
1: 0
2: 0
3: 9
4: 132

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152494456 Original CRISPR CACGGGACCAGGATTGGAAG TGG Intronic