ID: 1152494945

View in Genome Browser
Species Human (GRCh38)
Location 17:80664471-80664493
Sequence GAGGAGAAGGAGAAGGGGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 4159
Summary {0: 1, 1: 5, 2: 53, 3: 596, 4: 3504}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152494945 Original CRISPR GAGGAGAAGGAGAAGGGGGC AGG (reversed) Intronic
Too many off-targets to display for this crispr