ID: 1152496664

View in Genome Browser
Species Human (GRCh38)
Location 17:80677628-80677650
Sequence TGCCCAGCAAACGCCTGAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 163
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 153}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152496664 Original CRISPR TGCCCAGCAAACGCCTGAAA AGG (reversed) Intronic
900098840 1:952376-952398 TGCCCAGCATGAGCCTGGAAGGG + Intronic
901572959 1:10176654-10176676 TGGCCAGCAAGCACATGAAAAGG - Intronic
903294020 1:22332289-22332311 TGCTCAGCAAATGCTTGCAAAGG + Intergenic
908573903 1:65439084-65439106 TGCCCAGCAGTACCCTGAAATGG - Intronic
909867413 1:80690910-80690932 TCCCCAGCAAAAGACTCAAAAGG + Intergenic
910044065 1:82890543-82890565 TGCACTGCAAACACCTGAATTGG - Intergenic
914394952 1:147256956-147256978 TGTCCAGCAAACAGCTCAAATGG - Intronic
916238761 1:162617535-162617557 TGTCCAGAAAAGACCTGAAAAGG - Intergenic
917563311 1:176182718-176182740 TGCCGAACAATGGCCTGAAAAGG + Intronic
918071910 1:181139510-181139532 TGCCCTGCAGACACCTGCAAGGG - Intergenic
922008785 1:221559683-221559705 CTCCCAGGCAACGCCTGAAATGG - Intergenic
922265451 1:223979651-223979673 TGCCCAGCAAAAGCTCCAAACGG + Intergenic
922602633 1:226868950-226868972 TGGCCAACAAACACATGAAAAGG + Intergenic
922983223 1:229846503-229846525 TGCTGAGCAAACACCTGAGAAGG + Intergenic
924101652 1:240609552-240609574 TGCCCAGCACTCGGCTTAAATGG - Intronic
1065152014 10:22831613-22831635 TGCCACGAAAAGGCCTGAAAAGG + Intergenic
1067249816 10:44576758-44576780 TGCCCAGCAATCCCCACAAAAGG - Intergenic
1068586308 10:58803182-58803204 TGCCCAGCAAAACTCCGAAAGGG + Exonic
1070957682 10:80474967-80474989 TTTCCAGCAAGCTCCTGAAATGG + Intronic
1072913359 10:99522389-99522411 TGGCCAGCCAAGGCCTCAAAGGG + Intergenic
1073248772 10:102109137-102109159 AGCCCAGCAAACGGCGGAAACGG - Exonic
1076191417 10:128486003-128486025 TGCCCAGCAAGGGCCTGCCATGG - Intergenic
1076316687 10:129546859-129546881 TGCTCAGCATATGCCTGAACTGG + Intronic
1076412567 10:130262394-130262416 AGCCCAGAAAACGACTGCAAAGG - Intergenic
1076775355 10:132693210-132693232 TGCCCAGTAAAAGCCAGAGAAGG + Intronic
1077150474 11:1070836-1070858 TGCCCAGCAGAGGCCTGGACTGG + Intergenic
1079578446 11:22031666-22031688 TTCCCAGCAAAGACCTGATAAGG - Intergenic
1085778382 11:79386625-79386647 TGGCCAGTAAACACATGAAAAGG + Intronic
1088545653 11:110956205-110956227 TCCAGAGCAAACCCCTGAAAGGG - Intergenic
1091495483 12:968742-968764 TGCCCAGCAAAGATCTGAGAAGG + Intronic
1093113013 12:15175495-15175517 TGCCCAGTAAAGACCTGAGACGG - Intronic
1098329720 12:69340628-69340650 TGCACAGCAAATACCAGAAATGG + Intergenic
1100330531 12:93577732-93577754 TCCCCTGAACACGCCTGAAAGGG + Intronic
1103454966 12:121058245-121058267 TGCCGAGAATACGACTGAAAAGG - Intergenic
1106181622 13:27374294-27374316 TGCCCAGCAAAGTCCTGACTTGG + Intergenic
1107067689 13:36232992-36233014 TACTCAGGAAAGGCCTGAAAAGG + Intronic
1108240810 13:48461753-48461775 TGGCCAGTAAACACATGAAAAGG - Intronic
1113492487 13:110703372-110703394 AGCCCAGCAAAGGCCTGGAGGGG + Intronic
1115082482 14:29473573-29473595 TGCCCAGGAAACACCTAAAAAGG - Intergenic
1117720096 14:58620556-58620578 TGCCCATAAAACGCTTGATAAGG - Intergenic
1120353417 14:83394350-83394372 TGCTCAGGAAAGACCTGAAAAGG + Intergenic
1121481772 14:94283764-94283786 CCCCCAGCAGATGCCTGAAACGG - Exonic
1121991651 14:98563629-98563651 TGGCCATCAAACCCTTGAAATGG + Intergenic
1124093588 15:26628835-26628857 GGGCCAGCAGAGGCCTGAAACGG + Intronic
1124403108 15:29367626-29367648 TGCCCAGGAAAGCCCTGAGAAGG + Intronic
1125886396 15:43232945-43232967 TGCCTAGCATATGCCAGAAATGG + Exonic
1125895426 15:43298063-43298085 TTCTCACCAACCGCCTGAAATGG + Intronic
1128988678 15:72240554-72240576 AGGCCAGCAAAAGGCTGAAATGG + Intergenic
1129704044 15:77784411-77784433 TGCCCAGCAAGCGGCTGATGAGG + Intronic
1133111850 16:3552543-3552565 TGCCCAGCAACCTCCCGAATGGG + Intronic
1135177401 16:20242824-20242846 TGCCCAGGAAAGACCTGAACAGG + Intergenic
1137504295 16:49038522-49038544 TGGCCAACAAACACATGAAAAGG - Intergenic
1141136800 16:81471639-81471661 TTCCCAGTAGATGCCTGAAATGG + Intronic
1141849676 16:86636760-86636782 TGCCCAGCAAAGGCAGGACAGGG - Intergenic
1143387578 17:6541018-6541040 TGCCCAACAAACTTCTGGAAAGG + Intronic
1143957361 17:10682042-10682064 TTCCCAGCAAAGTCCTAAAATGG + Intronic
1146749760 17:35368027-35368049 TGCTCAGCAAACTCCCTAAAAGG + Intronic
1146842231 17:36164036-36164058 TGCCCAGCACAGGCGTGGAACGG + Intergenic
1146854542 17:36251995-36252017 TGCCCAGCACAGGCGTGGAAGGG + Intronic
1146866078 17:36336381-36336403 TGCCCAGCACAGGCGTGGAACGG - Intronic
1146870442 17:36375887-36375909 TGCCCAGCACAGGCGTGGAACGG + Intronic
1146877799 17:36426968-36426990 TGCCCAGCACAGGCGTGGAACGG + Intronic
1147068948 17:37936993-37937015 TGCCCAGCACAGGCGTGGAACGG - Intergenic
1147073325 17:37976511-37976533 TGCCCAGCACAGGCGTGGAACGG + Intergenic
1147080472 17:38016530-38016552 TGCCCAGCACAGGCGTGGAACGG - Intronic
1147084846 17:38056049-38056071 TGCCCAGCACAGGCGTGGAACGG + Intronic
1147096419 17:38140490-38140512 TGCCCAGCACAGGCGTGGAACGG - Intergenic
1147100794 17:38180015-38180037 TGCCCAGCACAGGCGTGGAACGG + Intergenic
1148867770 17:50637881-50637903 TCCCCAGCAAACAGCTGAAATGG - Intronic
1150083727 17:62263062-62263084 TGCCCAGCACAGGCGTGGAATGG + Intergenic
1150577298 17:66441581-66441603 TGCCCAGAAACCACCTGAAGAGG - Intronic
1152496664 17:80677628-80677650 TGCCCAGCAAACGCCTGAAAAGG - Intronic
1152754659 17:82082220-82082242 TCCCCAGGAAACGCCAGAGAGGG + Intronic
1153020720 18:626377-626399 TGCCCACCAATAGCCTAAAAAGG - Intronic
1156838754 18:41586541-41586563 TGCCCAGCAAATCACTGAAAAGG + Intergenic
1157516074 18:48312340-48312362 TGGCCAGCAAAGGCCAGGAAGGG - Intronic
1159022691 18:63156187-63156209 TGCCCAGCAATAGCATGGAAGGG + Intronic
1159915198 18:74182382-74182404 ATCCCAGCAAACGCCAGGAAGGG + Intergenic
1160139312 18:76306793-76306815 TGCCTAGCAAAGGTCGGAAAGGG - Intergenic
1161067401 19:2245482-2245504 TGCCCAGCCCGCGCCTGAGAAGG + Exonic
1162173849 19:8814581-8814603 TGCCCAGAAAATACCTGAGAAGG + Intronic
925437554 2:3853540-3853562 TGCCCAGGAAAGACCTGAGAAGG - Intergenic
925583895 2:5443202-5443224 TGCCAACCATAAGCCTGAAAAGG - Intergenic
928242646 2:29600094-29600116 TGGCCAGCACAAGCCTGAATGGG + Intronic
928349487 2:30535824-30535846 AGCCTATCAAATGCCTGAAAAGG + Intronic
933649385 2:84837811-84837833 TGCCCAGGAAAGACCTGAGAAGG - Intronic
933695304 2:85213081-85213103 GGCCCAGAAAACGCCTTGAAGGG + Intronic
934540260 2:95167881-95167903 TGCCCCTCACACACCTGAAATGG - Intronic
936026245 2:109033178-109033200 GGCCCATCAACAGCCTGAAAGGG - Intergenic
936405974 2:112203155-112203177 TGCCCAAGAAAGACCTGAAAGGG + Intergenic
938420950 2:131146277-131146299 TGCCCAACAAAAGCCCAAAAAGG - Intronic
940961369 2:159790093-159790115 TGCTCAGCAAATGTCTGATATGG - Intronic
941255091 2:163219388-163219410 TGCCCAGGTAACACCTGAGAAGG + Intergenic
944969672 2:204977848-204977870 TTACCAGCTAAGGCCTGAAAGGG + Intronic
1168774822 20:438780-438802 AGCCCAGCAGAGGCCTGATATGG - Exonic
1170466961 20:16630966-16630988 TGCCCAGAAGACTCCTGTAATGG + Intergenic
1173322096 20:41997641-41997663 TCCCCTGAAAAGGCCTGAAAAGG - Intergenic
1173697689 20:45033871-45033893 TGCCCAGCCAATGTTTGAAAGGG + Intronic
1175809813 20:61851932-61851954 TGCCCATCAAGGGCCTGCAATGG - Intronic
1178674599 21:34620520-34620542 TGCCCAGCTAATGCCTGCCATGG + Intergenic
1179722089 21:43321713-43321735 TGCCCAGCAAGCGCCTCCCAGGG - Intergenic
1182290083 22:29269795-29269817 TGCTCTGCAAAAGCCTGAAAAGG + Intronic
950046570 3:9951899-9951921 TGCCGAGAAAACGGCTGAATGGG + Intronic
950392291 3:12706115-12706137 TGGCCAACAAACCCTTGAAAAGG + Intergenic
950724995 3:14911463-14911485 TGCCCAGCAGAGGGCTTAAAAGG - Intronic
952008076 3:28865614-28865636 TGCCCAGCAAAAGAAAGAAAGGG - Intergenic
952818779 3:37468155-37468177 TGCCCAGCAAACACCTGGGGAGG + Intronic
956079186 3:65539470-65539492 TGCCAAGCAACCATCTGAAATGG + Intronic
956943445 3:74192180-74192202 TGCCCAGCAAAGTACTGAGAAGG - Intergenic
963416819 3:145006478-145006500 TGATCAGCAAACTCCTGAAGAGG - Intergenic
965606362 3:170501332-170501354 TGCATAGCAGACGCCTGCAAGGG + Exonic
966812908 3:183864292-183864314 TGGCCAGCAAGAGCCTGAGAAGG - Intronic
967377284 3:188818857-188818879 TGACCAGCAAAAGCCTGGGAAGG - Intronic
967619589 3:191616817-191616839 TGTTCAGGAAAGGCCTGAAAAGG + Intergenic
971155165 4:24074065-24074087 GGCCCAGCAAATGCAGGAAAGGG + Intergenic
972380444 4:38514513-38514535 AGCCCAGAAAACCCCTGAGATGG + Intergenic
980667663 4:135960146-135960168 TGCCCAGCATCCTCCGGAAAAGG + Intergenic
984073207 4:175142858-175142880 TGGCCAGCAAATGTATGAAAAGG - Intergenic
984321403 4:178201685-178201707 TACCCAGCAAAATGCTGAAAGGG + Intergenic
988051831 5:26041435-26041457 TGCCCAGCCAAGGACTGAGAGGG + Intergenic
992146294 5:73852866-73852888 TGCACAGCCAAGGACTGAAAGGG - Intronic
993262757 5:85680920-85680942 TGTCCAGTAAACACATGAAAAGG + Intergenic
993521529 5:88908282-88908304 TTTCCACTAAACGCCTGAAAAGG - Intergenic
994110183 5:95993844-95993866 TGCCCAGTAAGCACATGAAAAGG + Intergenic
994469302 5:100182103-100182125 TGATCAGCAAAAACCTGAAAAGG - Intergenic
994998422 5:107094918-107094940 TCCCCAGCAAAGGCCCTAAATGG - Intergenic
995044646 5:107632030-107632052 TGCCCAGCACATGGCTGAGAGGG + Intronic
998518344 5:142777029-142777051 TGGCCAACAAACACATGAAAAGG - Intronic
1000341761 5:160282681-160282703 TGACCAACAAACACATGAAAAGG + Intronic
1002759557 6:191208-191230 CGCCCAGCACACGACTGAGATGG + Intergenic
1002961492 6:1919093-1919115 TGCCCAGTAAATACCTGAATTGG - Intronic
1007146789 6:39642801-39642823 TGCCCAGAAAAGACCTGAGAAGG + Intronic
1015852402 6:137588200-137588222 AACCCAGCAAACACCTGAGATGG + Intergenic
1016861258 6:148721001-148721023 TGCCCAGCAAACTAGTGAACAGG - Intergenic
1016997988 6:149974508-149974530 TGCCCAGGAAGCACCTGAGAAGG + Intergenic
1017000286 6:149991712-149991734 TGCCCAGGAAGCACCTGAGAAGG - Intergenic
1017010513 6:150060211-150060233 TGCCCAGGAAGCACCTGAGAAGG - Intergenic
1018099284 6:160421776-160421798 TCCCCAGCAGACGCTTGAAACGG - Intronic
1018582671 6:165320883-165320905 TGGCCAGTAAACTCATGAAAAGG - Intergenic
1022517385 7:30984520-30984542 TGCCCAGCAAACGGTAGAAAGGG - Intronic
1023525449 7:41097580-41097602 AGCCCAGCAAAAACCTCAAATGG - Intergenic
1025313266 7:57979941-57979963 TTTCCACCATACGCCTGAAAGGG + Intergenic
1026094372 7:67331394-67331416 TTTCCACTAAACGCCTGAAAAGG + Intergenic
1030125350 7:106147984-106148006 TGGCCAGAAAATGCATGAAAAGG - Intergenic
1030481634 7:110111819-110111841 TGCTCAGGAAATGCCTGAGAAGG - Intergenic
1032225917 7:130031716-130031738 TGCCCAGCAAAGACCTGAAAAGG + Intronic
1033715620 7:143998844-143998866 TGCTCAGAAAAGGCCTGAGAAGG + Intergenic
1038514844 8:28178863-28178885 TGGCCAGTAAACACATGAAAAGG - Intronic
1040073869 8:43210410-43210432 TGCAAATCAAACTCCTGAAAAGG + Intergenic
1047191717 8:122684415-122684437 TGTCCAGAAAAAGCCTGAAGAGG + Intergenic
1048566594 8:135606206-135606228 TGCCCAGAAAAGACCTGAGAGGG - Intronic
1048628924 8:136219016-136219038 TCCCCAGCAAAGGCCTGGGAGGG - Intergenic
1052687805 9:31776697-31776719 AGCCCAGATAAAGCCTGAAAAGG - Intergenic
1056453309 9:86737487-86737509 TGCCCTGCAAGCTTCTGAAAGGG + Intergenic
1058719883 9:107754210-107754232 TGCCAAGCAAAAGGCGGAAAAGG - Intergenic
1185969587 X:4647693-4647715 TGCCTAGCAAAAGGGTGAAAAGG + Intergenic
1186426270 X:9465801-9465823 TGCCCAGCAAGCCCCTGAATCGG - Intronic
1190574920 X:51825727-51825749 TGCTCAGGAAACACCTGAGAAGG - Intronic
1193103736 X:77644393-77644415 ATCCCAGCAAACCCTTGAAAAGG + Intronic
1196113735 X:111975045-111975067 TGCCCAGAAAGCACCTGAGAAGG + Intronic
1197621096 X:128749846-128749868 TGCTCAGGAAAGGCCTGAGAAGG + Intergenic
1197849944 X:130847034-130847056 TCCCCAGAAATCTCCTGAAAAGG + Intronic
1200036716 X:153335664-153335686 TGCCCAGGAACCTGCTGAAATGG - Intronic