ID: 1152500436

View in Genome Browser
Species Human (GRCh38)
Location 17:80705015-80705037
Sequence AGCGTGTCACCTGCTCCCAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 81
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 75}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152500436 Original CRISPR AGCGTGTCACCTGCTCCCAT AGG (reversed) Intronic
900447411 1:2688250-2688272 AGGCTGTCACATGCTCCCCTGGG - Intronic
900449215 1:2697245-2697267 AGGGTGTCACTTGCTCACCTGGG - Intronic
900451282 1:2751129-2751151 AGGGTGTCAGATGCTCCCCTGGG - Intronic
900453882 1:2764343-2764365 AGGCTGTCACCTGCTCACTTGGG - Intronic
900455328 1:2771605-2771627 AGGCTGTCACCTGCTCACTTGGG - Intronic
900799483 1:4728478-4728500 TGAGTGACACCTGCTCCCAGTGG + Intronic
901657943 1:10781316-10781338 AGCCTGGCACCTGTTCCCAGAGG - Intronic
902936260 1:19766940-19766962 GCCCTGGCACCTGCTCCCATTGG + Intronic
905493098 1:38360837-38360859 AGCAGGTCACCTGCACCCCTGGG - Intergenic
905798651 1:40829658-40829680 ACCGTGTCACCTACTCTCAGAGG - Intronic
906477740 1:46181198-46181220 AGCTTGTGACCTGCTCCTATAGG - Intronic
914847892 1:151292846-151292868 AGCGTGTCACATGATGCCGTTGG + Exonic
920938134 1:210455133-210455155 AGCCTTTCAGCTGCTCCCAGAGG - Intronic
1063449884 10:6144497-6144519 AGCGTGTCCCCTGTGCCCGTAGG + Intergenic
1071877176 10:89854067-89854089 AGTGCGTCCCCTGCTCCTATAGG - Intergenic
1075466070 10:122651021-122651043 AGCTTGTCACCTTCTCCCAGAGG + Intergenic
1076203027 10:128573103-128573125 TGCCTGTCCCCTGCTCCCCTGGG - Intergenic
1087550558 11:99641974-99641996 AGCATGTGACCTCCTCCCTTTGG + Intronic
1090615485 11:128510565-128510587 AGTGTGTCTCCTCCTCCAATTGG - Intronic
1098918864 12:76284560-76284582 AGCGTTCCACATGCCCCCATAGG - Intergenic
1102494970 12:113313282-113313304 ACCGTGTCACCTGCATCAATAGG - Intronic
1107555827 13:41516077-41516099 AGCCCCTCACCTGCTCCCAGAGG - Intergenic
1112017387 13:95342647-95342669 AGCTTGTCAAGTGCACCCATTGG + Intergenic
1118322207 14:64759776-64759798 AGAGTGTCCCCTGCTCCGGTGGG - Intronic
1119703705 14:76771367-76771389 AGGGTGGCACCTGCCCCCAAAGG - Intronic
1120136762 14:80878656-80878678 AGTGTGGTGCCTGCTCCCATGGG + Intronic
1140809387 16:78562591-78562613 GGCCTGTCACTTACTCCCATTGG + Intronic
1144709913 17:17394674-17394696 TGCGGGTCACCTACTTCCATGGG - Intergenic
1152500436 17:80705015-80705037 AGCGTGTCACCTGCTCCCATAGG - Intronic
1152834180 17:82519225-82519247 AACGTGTCACCGGGTCCCCTGGG + Intergenic
1157509840 18:48263056-48263078 AGAGTGGCCCCAGCTCCCATGGG + Intronic
1157978085 18:52349209-52349231 ATTTTTTCACCTGCTCCCATGGG + Intronic
1158069755 18:53456850-53456872 AGGGTGACACCTGTTCCTATAGG + Intronic
1160236331 18:77089073-77089095 AGCCTGTCACATCCTCCCACGGG + Intronic
1160628891 18:80231724-80231746 AGCGAGTGAATTGCTCCCATTGG - Intronic
1161380747 19:3963845-3963867 AGTGTACCACCTGCTCCCACCGG - Intronic
1164573008 19:29387625-29387647 AGCATGTCACTTCCTCCCCTGGG + Intergenic
1165105281 19:33465550-33465572 GGCATCTCAGCTGCTCCCATGGG - Intronic
925156410 2:1651711-1651733 CACGTGTCACCTTCGCCCATGGG + Intronic
926104086 2:10139489-10139511 AGCTTGTCACCAGCTCACAGTGG - Intergenic
927496910 2:23557231-23557253 AGTGTGTCACAAGGTCCCATGGG - Intronic
928447987 2:31349930-31349952 TGCCTGTCATCTGCCCCCATGGG + Intronic
929189879 2:39130065-39130087 AGACTGCCACCTGCTCCCTTTGG + Intergenic
930352231 2:50271573-50271595 AATGTGTCACTTGCTCTCATTGG - Intronic
931671316 2:64650832-64650854 AGGGTGACACCAGCTCTCATAGG - Intronic
932024181 2:68116816-68116838 ACTGTGTCAGCAGCTCCCATGGG + Intergenic
936286551 2:111185738-111185760 AGCGTGTCACCCGCTCCCTGGGG + Intergenic
936377050 2:111949741-111949763 AGTGGGTCACCATCTCCCATAGG + Intronic
1171393035 20:24813666-24813688 AGCCTGTCCCCTGCTCTCCTGGG + Intergenic
1178561218 21:33641746-33641768 AGCCCGCCCCCTGCTCCCATTGG + Exonic
1180675490 22:17583394-17583416 AGCCTGACGCCTGTTCCCATAGG + Exonic
1181510377 22:23386281-23386303 ACCGTGTTTCCTGCTCCAATAGG + Intergenic
1184775833 22:46622267-46622289 AGCGTGTCCCCTGCTTTCCTTGG + Intronic
1184852068 22:47126687-47126709 AGGGTGTCACCTGCTGGGATGGG + Intronic
951391066 3:22104298-22104320 AGTGTGTCTCCTGCTACCAAAGG + Intronic
962453070 3:135538084-135538106 AGCCTGGCTCCTTCTCCCATTGG + Intergenic
967858693 3:194136028-194136050 CGCGTGTCTCCTCCTCCCATTGG + Intergenic
967985664 3:195093990-195094012 AGAGTGTCAGCTGCTCCCCTCGG + Intronic
968269681 3:197393853-197393875 CCCGTGTCATCTGCTCCCTTTGG - Intergenic
973732912 4:53840795-53840817 AGCCTGTCACCTGGCTCCATGGG - Intronic
976824707 4:89248273-89248295 AGCCTGCCATCTGATCCCATGGG - Exonic
985571123 5:645874-645896 AGCGTCACTCCTGCTCCCGTCGG + Intronic
985571132 5:645939-645961 AGCGTCACTCCTGCTCCCGTTGG + Intronic
985571144 5:646004-646026 AGCGTCACTCTTGCTCCCATCGG + Intronic
985571151 5:646069-646091 AGCGTCACTCTTGCTCCCATTGG + Intronic
1002292412 5:178209022-178209044 AGCCTGTCCTCTGCTCCCCTGGG + Intronic
1003144007 6:3494389-3494411 ACCATGCCACCTGCTCCCAAGGG + Intergenic
1007306234 6:40907560-40907582 AGCGTGCCACCTGCTTCCTGAGG - Intergenic
1009488388 6:64254654-64254676 AGCTTGTCAGCTGCTCACCTGGG + Intronic
1024246668 7:47475935-47475957 AGCGTGTCCCCTGCTTCCTGAGG - Intronic
1029284302 7:99455465-99455487 ACCTTGTGACCTGCTCCCCTCGG - Intronic
1039433464 8:37543643-37543665 GCCGTGTTACCTGCTCCCCTTGG - Intergenic
1048608821 8:135999749-135999771 AGTGTATCTCCTGCTCACATTGG + Intergenic
1049549853 8:143252225-143252247 AGCCCGTCACCTGCTCACACTGG + Intronic
1051332827 9:16040545-16040567 AGCGTGTGACCTGCACCACTGGG - Intronic
1057184572 9:93049754-93049776 AGGGTGTCTCCTGCTCCACTGGG + Intergenic
1062128480 9:134879828-134879850 ACCCTGCCACCTGCTGCCATCGG - Intergenic
1062243906 9:135553537-135553559 AGCGTACAAGCTGCTCCCATCGG + Intergenic
1189984731 X:46544114-46544136 AGCAGGGCACCTGCCCCCATGGG + Intronic
1190030030 X:46963159-46963181 AGCGTGGCACCTGCAACCAGTGG - Intronic
1200384954 X:155881262-155881284 GCCGTGTCGCCTGCTGCCATTGG + Intergenic